Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628912_at:

>probe:Drosophila_2:1628912_at:284:297; Interrogation_Position=1009; Antisense; CGCAGTTCGCAGTTGGTGCAAATGA
>probe:Drosophila_2:1628912_at:153:365; Interrogation_Position=1079; Antisense; GAATAGCAACGGTAGCCTCGGCCAA
>probe:Drosophila_2:1628912_at:504:111; Interrogation_Position=1190; Antisense; AGCAACATCTGCAGTTCGCCTTCAA
>probe:Drosophila_2:1628912_at:713:233; Interrogation_Position=1213; Antisense; AATCCATTGCAACCTGAAGCTGGGA
>probe:Drosophila_2:1628912_at:331:399; Interrogation_Position=1280; Antisense; GACAGCAATCATCGCGAACCATGGA
>probe:Drosophila_2:1628912_at:480:367; Interrogation_Position=1317; Antisense; GAATCGACCCAGGAAGAGCACACCT
>probe:Drosophila_2:1628912_at:649:213; Interrogation_Position=1330; Antisense; AAGAGCACACCTGCGGCCAGCAAGA
>probe:Drosophila_2:1628912_at:586:543; Interrogation_Position=1359; Antisense; GGACAACCCCTATGAGAAGTACCCA
>probe:Drosophila_2:1628912_at:690:369; Interrogation_Position=1374; Antisense; GAAGTACCCATCACCAAAAATCCAA
>probe:Drosophila_2:1628912_at:188:339; Interrogation_Position=1410; Antisense; GCTCTTAAGCCTCACCTATACGAAA
>probe:Drosophila_2:1628912_at:70:179; Interrogation_Position=1491; Antisense; AAACAAGTGCTTCTATTACCATTTG
>probe:Drosophila_2:1628912_at:71:15; Interrogation_Position=1505; Antisense; ATTACCATTTGATTTACGCCATTTG
>probe:Drosophila_2:1628912_at:254:673; Interrogation_Position=1519; Antisense; TACGCCATTTGCTGCAATTCGTTTG
>probe:Drosophila_2:1628912_at:127:247; Interrogation_Position=1534; Antisense; AATTCGTTTGATTTTCTTGCTTGTA

Paste this into a BLAST search page for me
CGCAGTTCGCAGTTGGTGCAAATGAGAATAGCAACGGTAGCCTCGGCCAAAGCAACATCTGCAGTTCGCCTTCAAAATCCATTGCAACCTGAAGCTGGGAGACAGCAATCATCGCGAACCATGGAGAATCGACCCAGGAAGAGCACACCTAAGAGCACACCTGCGGCCAGCAAGAGGACAACCCCTATGAGAAGTACCCAGAAGTACCCATCACCAAAAATCCAAGCTCTTAAGCCTCACCTATACGAAAAAACAAGTGCTTCTATTACCATTTGATTACCATTTGATTTACGCCATTTGTACGCCATTTGCTGCAATTCGTTTGAATTCGTTTGATTTTCTTGCTTGTA

Full Affymetrix probeset data:

Annotations for 1628912_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime