FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628913_at:

>probe:Drosophila_2:1628913_at:669:461; Interrogation_Position=1689; Antisense; GATTAGCTCCTTTCACGATGTCGGC
>probe:Drosophila_2:1628913_at:175:301; Interrogation_Position=1717; Antisense; CCCCTGAGTTCCACCTTGATGAATG
>probe:Drosophila_2:1628913_at:712:613; Interrogation_Position=1736; Antisense; TGAATGGAAACCAGCGACGCCTGTC
>probe:Drosophila_2:1628913_at:64:347; Interrogation_Position=1775; Antisense; GCAGGAACTCCACACTAAAGTCCGG
>probe:Drosophila_2:1628913_at:237:525; Interrogation_Position=1813; Antisense; GGGCTGCCCATGCAAAATCAGACTC
>probe:Drosophila_2:1628913_at:464:473; Interrogation_Position=1840; Antisense; GTTCAAGTACAGGTTCAAGCTCAGA
>probe:Drosophila_2:1628913_at:144:253; Interrogation_Position=1855; Antisense; CAAGCTCAGATATCAACCGCTCCAT
>probe:Drosophila_2:1628913_at:30:711; Interrogation_Position=1921; Antisense; TTCTCCACTTTGTCCAACGAGGATG
>probe:Drosophila_2:1628913_at:102:353; Interrogation_Position=1945; Antisense; GCAGCCGCTGTTTTATGGGTCTAGA
>probe:Drosophila_2:1628913_at:515:693; Interrogation_Position=2068; Antisense; TTTTATTTTGAACACCCCGTAGCTG
>probe:Drosophila_2:1628913_at:58:153; Interrogation_Position=2079; Antisense; ACACCCCGTAGCTGTTTCGATTTGT
>probe:Drosophila_2:1628913_at:276:717; Interrogation_Position=2094; Antisense; TTCGATTTGTTTTCTCTAGTGCCTC
>probe:Drosophila_2:1628913_at:43:507; Interrogation_Position=2112; Antisense; GTGCCTCCGCTTAGTGTTTAATTGA
>probe:Drosophila_2:1628913_at:457:413; Interrogation_Position=2194; Antisense; GACCAAGCGCGCATTTCTATGTTAA

Paste this into a BLAST search page for me
GATTAGCTCCTTTCACGATGTCGGCCCCCTGAGTTCCACCTTGATGAATGTGAATGGAAACCAGCGACGCCTGTCGCAGGAACTCCACACTAAAGTCCGGGGGCTGCCCATGCAAAATCAGACTCGTTCAAGTACAGGTTCAAGCTCAGACAAGCTCAGATATCAACCGCTCCATTTCTCCACTTTGTCCAACGAGGATGGCAGCCGCTGTTTTATGGGTCTAGATTTTATTTTGAACACCCCGTAGCTGACACCCCGTAGCTGTTTCGATTTGTTTCGATTTGTTTTCTCTAGTGCCTCGTGCCTCCGCTTAGTGTTTAATTGAGACCAAGCGCGCATTTCTATGTTAA

Full Affymetrix probeset data:

Annotations for 1628913_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720