Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628914_at:

>probe:Drosophila_2:1628914_at:730:525; Interrogation_Position=1645; Antisense; GGGACACGCTATTTCAGTGCTGGCA
>probe:Drosophila_2:1628914_at:117:127; Interrogation_Position=1720; Antisense; AGCCGGACTGCAGCCTTATAGGGTA
>probe:Drosophila_2:1628914_at:728:703; Interrogation_Position=1735; Antisense; TTATAGGGTATACTCGCGCGATGGC
>probe:Drosophila_2:1628914_at:500:471; Interrogation_Position=1763; Antisense; GTTCTGGCGCAGTTCATGGACAAGT
>probe:Drosophila_2:1628914_at:717:129; Interrogation_Position=1819; Antisense; ACCCTCTTATGTGCTAAACGGCTTT
>probe:Drosophila_2:1628914_at:302:705; Interrogation_Position=1842; Antisense; TTATCTATTCACTGCTGGGTCTCTA
>probe:Drosophila_2:1628914_at:461:589; Interrogation_Position=1857; Antisense; TGGGTCTCTACGATCTCAACAGCAC
>probe:Drosophila_2:1628914_at:98:165; Interrogation_Position=1893; Antisense; AAATCGCCCGCGAGGCTGGAAAGCT
>probe:Drosophila_2:1628914_at:606:287; Interrogation_Position=1908; Antisense; CTGGAAAGCTTTTCGCGCAGGGCAT
>probe:Drosophila_2:1628914_at:63:623; Interrogation_Position=1950; Antisense; TGCTGTTGCTATTTGACACTGGCTC
>probe:Drosophila_2:1628914_at:694:527; Interrogation_Position=2034; Antisense; GGGACTACCATGCAACGCACGTGAA
>probe:Drosophila_2:1628914_at:253:93; Interrogation_Position=2061; Antisense; AGTTACTTCTGTTAGCCACCATCGA
>probe:Drosophila_2:1628914_at:516:399; Interrogation_Position=2084; Antisense; GACAGCGATCCATTAATTGCACAAA
>probe:Drosophila_2:1628914_at:530:341; Interrogation_Position=2127; Antisense; GCTATATGTTTGGTCGTCGGGCCAA

Paste this into a BLAST search page for me
GGGACACGCTATTTCAGTGCTGGCAAGCCGGACTGCAGCCTTATAGGGTATTATAGGGTATACTCGCGCGATGGCGTTCTGGCGCAGTTCATGGACAAGTACCCTCTTATGTGCTAAACGGCTTTTTATCTATTCACTGCTGGGTCTCTATGGGTCTCTACGATCTCAACAGCACAAATCGCCCGCGAGGCTGGAAAGCTCTGGAAAGCTTTTCGCGCAGGGCATTGCTGTTGCTATTTGACACTGGCTCGGGACTACCATGCAACGCACGTGAAAGTTACTTCTGTTAGCCACCATCGAGACAGCGATCCATTAATTGCACAAAGCTATATGTTTGGTCGTCGGGCCAA

Full Affymetrix probeset data:

Annotations for 1628914_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime