FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628917_at:

>probe:Drosophila_2:1628917_at:232:169; Interrogation_Position=143; Antisense; AAATGGTGACATCGCGCTGGAGAAA
>probe:Drosophila_2:1628917_at:325:115; Interrogation_Position=192; Antisense; AGCAGTTCTCTGGAGGCTCAGCCAA
>probe:Drosophila_2:1628917_at:547:279; Interrogation_Position=208; Antisense; CTCAGCCAAATTTAAGCACTTCGGA
>probe:Drosophila_2:1628917_at:295:423; Interrogation_Position=237; Antisense; GAGACAATTGTGAGAAACGCCGTTA
>probe:Drosophila_2:1628917_at:77:475; Interrogation_Position=258; Antisense; GTTAAACAGATTCCAACACCTCCAA
>probe:Drosophila_2:1628917_at:300:187; Interrogation_Position=272; Antisense; AACACCTCCAAACTATGTCGACGTA
>probe:Drosophila_2:1628917_at:234:345; Interrogation_Position=307; Antisense; GCATTGCAAATGCTATTCTGCCCAA
>probe:Drosophila_2:1628917_at:47:47; Interrogation_Position=383; Antisense; ATCCCTGGACACTTATAGTCGGCAA
>probe:Drosophila_2:1628917_at:137:211; Interrogation_Position=550; Antisense; AAGACTTACTGAACCAGTCGCGCCA
>probe:Drosophila_2:1628917_at:651:501; Interrogation_Position=566; Antisense; GTCGCGCCATTATCTCACAAACGAT
>probe:Drosophila_2:1628917_at:679:197; Interrogation_Position=585; Antisense; AACGATCCCAAAGAGTTGAGTGCCC
>probe:Drosophila_2:1628917_at:466:699; Interrogation_Position=600; Antisense; TTGAGTGCCCATCTTGTTGGTCCAC
>probe:Drosophila_2:1628917_at:16:3; Interrogation_Position=615; Antisense; GTTGGTCCACCAACGGAAGTCCCAT
>probe:Drosophila_2:1628917_at:275:563; Interrogation_Position=629; Antisense; GGAAGTCCCATCGATTCAAAAGGTA

Paste this into a BLAST search page for me
AAATGGTGACATCGCGCTGGAGAAAAGCAGTTCTCTGGAGGCTCAGCCAACTCAGCCAAATTTAAGCACTTCGGAGAGACAATTGTGAGAAACGCCGTTAGTTAAACAGATTCCAACACCTCCAAAACACCTCCAAACTATGTCGACGTAGCATTGCAAATGCTATTCTGCCCAAATCCCTGGACACTTATAGTCGGCAAAAGACTTACTGAACCAGTCGCGCCAGTCGCGCCATTATCTCACAAACGATAACGATCCCAAAGAGTTGAGTGCCCTTGAGTGCCCATCTTGTTGGTCCACGTTGGTCCACCAACGGAAGTCCCATGGAAGTCCCATCGATTCAAAAGGTA

Full Affymetrix probeset data:

Annotations for 1628917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720