Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628923_at:

>probe:Drosophila_2:1628923_at:477:211; Interrogation_Position=106; Antisense; AAGAAGCAGGTCTTCGAGCTCCTCT
>probe:Drosophila_2:1628923_at:540:665; Interrogation_Position=145; Antisense; TACAGCCCCGATGGATATGCACGAG
>probe:Drosophila_2:1628923_at:656:133; Interrogation_Position=165; Antisense; ACGAGCCATCGAAACCCTAGAATTT
>probe:Drosophila_2:1628923_at:253:123; Interrogation_Position=209; Antisense; AGCGATACCGCTTCAAGATTGTCAT
>probe:Drosophila_2:1628923_at:618:135; Interrogation_Position=236; Antisense; ACGAACTGGAGCTGTCGAGTGCCGC
>probe:Drosophila_2:1628923_at:232:41; Interrogation_Position=25; Antisense; ATCGGCCTGGACTACATTGTCGAGA
>probe:Drosophila_2:1628923_at:263:623; Interrogation_Position=293; Antisense; TGCTGGCCTTCATCAACTGTGTCAT
>probe:Drosophila_2:1628923_at:601:33; Interrogation_Position=304; Antisense; ATCAACTGTGTCATCATCTCGGCGG
>probe:Drosophila_2:1628923_at:494:573; Interrogation_Position=324; Antisense; GGCGGCCACTCTACAGGAGCGGATT
>probe:Drosophila_2:1628923_at:72:643; Interrogation_Position=333; Antisense; TCTACAGGAGCGGATTCGCATTCGC
>probe:Drosophila_2:1628923_at:134:513; Interrogation_Position=371; Antisense; GTGAGAAGAGCGATCGAATCCCATA
>probe:Drosophila_2:1628923_at:63:501; Interrogation_Position=43; Antisense; GTCGAGAATCGTGACTACATTGCTA
>probe:Drosophila_2:1628923_at:293:147; Interrogation_Position=56; Antisense; ACTACATTGCTAAGCTGGGCGCTGC
>probe:Drosophila_2:1628923_at:602:109; Interrogation_Position=92; Antisense; AGAATGCCACCGTCAAGAAGCAGGT

Paste this into a BLAST search page for me
AAGAAGCAGGTCTTCGAGCTCCTCTTACAGCCCCGATGGATATGCACGAGACGAGCCATCGAAACCCTAGAATTTAGCGATACCGCTTCAAGATTGTCATACGAACTGGAGCTGTCGAGTGCCGCATCGGCCTGGACTACATTGTCGAGATGCTGGCCTTCATCAACTGTGTCATATCAACTGTGTCATCATCTCGGCGGGGCGGCCACTCTACAGGAGCGGATTTCTACAGGAGCGGATTCGCATTCGCGTGAGAAGAGCGATCGAATCCCATAGTCGAGAATCGTGACTACATTGCTAACTACATTGCTAAGCTGGGCGCTGCAGAATGCCACCGTCAAGAAGCAGGT

Full Affymetrix probeset data:

Annotations for 1628923_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime