Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628924_a_at:

>probe:Drosophila_2:1628924_a_at:261:387; Interrogation_Position=254; Antisense; GAACACGGACATTGCGCGCCAATAT
>probe:Drosophila_2:1628924_a_at:353:243; Interrogation_Position=274; Antisense; AATATGGACTGACCCCGGACAAGCT
>probe:Drosophila_2:1628924_a_at:376:159; Interrogation_Position=292; Antisense; ACAAGCTACCTCTGCTCGTGGAAAG
>probe:Drosophila_2:1628924_a_at:584:717; Interrogation_Position=342; Antisense; TTGCTAAGACTGATGACGACCTCCG
>probe:Drosophila_2:1628924_a_at:373:407; Interrogation_Position=356; Antisense; GACGACCTCCGACATAACTGAATAC
>probe:Drosophila_2:1628924_a_at:628:557; Interrogation_Position=401; Antisense; GGACATAACACTTCACTCCATGGAG
>probe:Drosophila_2:1628924_a_at:232:723; Interrogation_Position=456; Antisense; TTGCCCACTGAGTTTATTCACCTAT
>probe:Drosophila_2:1628924_a_at:275:111; Interrogation_Position=486; Antisense; AGCAATTGCATCTCGACTTGCGAAA
>probe:Drosophila_2:1628924_a_at:622:395; Interrogation_Position=519; Antisense; GACAAGTACATGCAGTCTCGCCTGG
>probe:Drosophila_2:1628924_a_at:571:591; Interrogation_Position=541; Antisense; TGGTGCGACTCGTTTGCGTATTTCT
>probe:Drosophila_2:1628924_a_at:107:329; Interrogation_Position=556; Antisense; GCGTATTTCTGCAGTCCTTGATTAG
>probe:Drosophila_2:1628924_a_at:223:205; Interrogation_Position=682; Antisense; AAGCCTTCTGCGTGGGTTTCAGCAA
>probe:Drosophila_2:1628924_a_at:169:233; Interrogation_Position=707; Antisense; AATCAAGGAGGCTGCTACCCTGTAC
>probe:Drosophila_2:1628924_a_at:146:597; Interrogation_Position=727; Antisense; TGTACCGGCTTATCAAACACTTGGA

Paste this into a BLAST search page for me
GAACACGGACATTGCGCGCCAATATAATATGGACTGACCCCGGACAAGCTACAAGCTACCTCTGCTCGTGGAAAGTTGCTAAGACTGATGACGACCTCCGGACGACCTCCGACATAACTGAATACGGACATAACACTTCACTCCATGGAGTTGCCCACTGAGTTTATTCACCTATAGCAATTGCATCTCGACTTGCGAAAGACAAGTACATGCAGTCTCGCCTGGTGGTGCGACTCGTTTGCGTATTTCTGCGTATTTCTGCAGTCCTTGATTAGAAGCCTTCTGCGTGGGTTTCAGCAAAATCAAGGAGGCTGCTACCCTGTACTGTACCGGCTTATCAAACACTTGGA

Full Affymetrix probeset data:

Annotations for 1628924_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime