FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628925_at:

>probe:Drosophila_2:1628925_at:703:381; Interrogation_Position=103; Antisense; GAACGCTGCAAGCTTATTATCGTAA
>probe:Drosophila_2:1628925_at:37:293; Interrogation_Position=129; Antisense; CGATCTGATCATGCTGGGAGTGGAT
>probe:Drosophila_2:1628925_at:579:543; Interrogation_Position=150; Antisense; GGATAATCCCGCTCATAGGAAGCTC
>probe:Drosophila_2:1628925_at:508:677; Interrogation_Position=165; Antisense; TAGGAAGCTCCTGCTCGAGGGAGTC
>probe:Drosophila_2:1628925_at:728:541; Interrogation_Position=184; Antisense; GGAGTCCGGTTCTTGGTCAACGCAC
>probe:Drosophila_2:1628925_at:289:283; Interrogation_Position=222; Antisense; CTGCAAGGAGCCGTGTGAGCTGCAT
>probe:Drosophila_2:1628925_at:22:411; Interrogation_Position=268; Antisense; GACCCGGATGTTGAGTTGTTTGCTT
>probe:Drosophila_2:1628925_at:209:481; Interrogation_Position=285; Antisense; GTTTGCTTCGCTAAAGTGCCTGGAA
>probe:Drosophila_2:1628925_at:671:623; Interrogation_Position=29; Antisense; TGCGCGATTGGTTGGTGCTATTGAC
>probe:Drosophila_2:1628925_at:623:105; Interrogation_Position=324; Antisense; AGAAACACCTGTTCCATATTCGCTA
>probe:Drosophila_2:1628925_at:675:271; Interrogation_Position=338; Antisense; CATATTCGCTAACATCTCCACAAAA
>probe:Drosophila_2:1628925_at:470:253; Interrogation_Position=358; Antisense; CAAAAGACGCTCACAACTCGGGACT
>probe:Drosophila_2:1628925_at:666:103; Interrogation_Position=372; Antisense; AACTCGGGACTCTTGCAAATGGAAT
>probe:Drosophila_2:1628925_at:296:517; Interrogation_Position=404; Antisense; GTGTGGATCAGTTACCTTCCGATAA

Paste this into a BLAST search page for me
GAACGCTGCAAGCTTATTATCGTAACGATCTGATCATGCTGGGAGTGGATGGATAATCCCGCTCATAGGAAGCTCTAGGAAGCTCCTGCTCGAGGGAGTCGGAGTCCGGTTCTTGGTCAACGCACCTGCAAGGAGCCGTGTGAGCTGCATGACCCGGATGTTGAGTTGTTTGCTTGTTTGCTTCGCTAAAGTGCCTGGAATGCGCGATTGGTTGGTGCTATTGACAGAAACACCTGTTCCATATTCGCTACATATTCGCTAACATCTCCACAAAACAAAAGACGCTCACAACTCGGGACTAACTCGGGACTCTTGCAAATGGAATGTGTGGATCAGTTACCTTCCGATAA

Full Affymetrix probeset data:

Annotations for 1628925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720