FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628926_at:

>probe:Drosophila_2:1628926_at:578:195; Interrogation_Position=105; Antisense; AACTGTCGACACATGCAGCAGGCAA
>probe:Drosophila_2:1628926_at:428:617; Interrogation_Position=118; Antisense; TGCAGCAGGCAAATTACACACGATG
>probe:Drosophila_2:1628926_at:276:7; Interrogation_Position=130; Antisense; ATTACACACGATGCAAAAAGCCTGC
>probe:Drosophila_2:1628926_at:283:183; Interrogation_Position=145; Antisense; AAAAGCCTGCATTTGCGGAGCATCG
>probe:Drosophila_2:1628926_at:452:19; Interrogation_Position=155; Antisense; ATTTGCGGAGCATCGAGGAGCCAGC
>probe:Drosophila_2:1628926_at:625:93; Interrogation_Position=194; Antisense; AGTTCCAGCCCACTGGCAGGATGAA
>probe:Drosophila_2:1628926_at:724:321; Interrogation_Position=201; Antisense; GCCCACTGGCAGGATGAACACGGAG
>probe:Drosophila_2:1628926_at:679:573; Interrogation_Position=244; Antisense; GGCGGCTACGGATCCAGCGAGCACT
>probe:Drosophila_2:1628926_at:623:685; Interrogation_Position=340; Antisense; TATCAGCCGCTGAACCACTCCGGAG
>probe:Drosophila_2:1628926_at:22:351; Interrogation_Position=444; Antisense; GCAGTACCAGGTGCAACAGCCGTAT
>probe:Drosophila_2:1628926_at:37:185; Interrogation_Position=458; Antisense; AACAGCCGTATCAGTACCAGTACCA
>probe:Drosophila_2:1628926_at:682:137; Interrogation_Position=530; Antisense; ACGATCCAGAGCACGCGCGGATGGA
>probe:Drosophila_2:1628926_at:149:627; Interrogation_Position=58; Antisense; TGCCAAGTGTGCGTCAAGGGCGAAA
>probe:Drosophila_2:1628926_at:56:595; Interrogation_Position=87; Antisense; TGGGCGGCAAGCTCATAAAACTGTC

Paste this into a BLAST search page for me
AACTGTCGACACATGCAGCAGGCAATGCAGCAGGCAAATTACACACGATGATTACACACGATGCAAAAAGCCTGCAAAAGCCTGCATTTGCGGAGCATCGATTTGCGGAGCATCGAGGAGCCAGCAGTTCCAGCCCACTGGCAGGATGAAGCCCACTGGCAGGATGAACACGGAGGGCGGCTACGGATCCAGCGAGCACTTATCAGCCGCTGAACCACTCCGGAGGCAGTACCAGGTGCAACAGCCGTATAACAGCCGTATCAGTACCAGTACCAACGATCCAGAGCACGCGCGGATGGATGCCAAGTGTGCGTCAAGGGCGAAATGGGCGGCAAGCTCATAAAACTGTC

Full Affymetrix probeset data:

Annotations for 1628926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720