Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628927_at:

>probe:Drosophila_2:1628927_at:89:103; Interrogation_Position=1090; Antisense; AGACTTTAGTCACAGTTCCCAGAGC
>probe:Drosophila_2:1628927_at:374:103; Interrogation_Position=1110; Antisense; AGAGCCGCATCCACATGAACAATGA
>probe:Drosophila_2:1628927_at:348:161; Interrogation_Position=1128; Antisense; ACAATGATACCTTGGTGTTCCCCAG
>probe:Drosophila_2:1628927_at:723:477; Interrogation_Position=1142; Antisense; GTGTTCCCCAGTGACATCAAGGTTG
>probe:Drosophila_2:1628927_at:235:197; Interrogation_Position=1176; Antisense; AACGTCTATGGGTCCTATCCAATCA
>probe:Drosophila_2:1628927_at:642:671; Interrogation_Position=1217; Antisense; TACGATGAACTGTACGCCGGCTCAA
>probe:Drosophila_2:1628927_at:618:571; Interrogation_Position=1235; Antisense; GGCTCAATAAACTTCCGTATCCTGA
>probe:Drosophila_2:1628927_at:1:633; Interrogation_Position=1248; Antisense; TCCGTATCCTGACTGCCAGTGTTAA
>probe:Drosophila_2:1628927_at:541:595; Interrogation_Position=1295; Antisense; TGTGAAATTAGAACTTCCCCTCTGC
>probe:Drosophila_2:1628927_at:233:137; Interrogation_Position=1366; Antisense; ACTGAAGTCCAATTCGGCTTCTTCC
>probe:Drosophila_2:1628927_at:257:119; Interrogation_Position=1403; Antisense; AGCTCCCTTATGCTGATTGCCTTAT
>probe:Drosophila_2:1628927_at:157:465; Interrogation_Position=1417; Antisense; GATTGCCTTATGTTTGCTGATGAGC
>probe:Drosophila_2:1628927_at:175:677; Interrogation_Position=1444; Antisense; TAGAATCTAGATTCCCGCAGCGGTA
>probe:Drosophila_2:1628927_at:409:255; Interrogation_Position=1469; Antisense; CAAAAGTATCTTGCGCACTTGCGAA

Paste this into a BLAST search page for me
AGACTTTAGTCACAGTTCCCAGAGCAGAGCCGCATCCACATGAACAATGAACAATGATACCTTGGTGTTCCCCAGGTGTTCCCCAGTGACATCAAGGTTGAACGTCTATGGGTCCTATCCAATCATACGATGAACTGTACGCCGGCTCAAGGCTCAATAAACTTCCGTATCCTGATCCGTATCCTGACTGCCAGTGTTAATGTGAAATTAGAACTTCCCCTCTGCACTGAAGTCCAATTCGGCTTCTTCCAGCTCCCTTATGCTGATTGCCTTATGATTGCCTTATGTTTGCTGATGAGCTAGAATCTAGATTCCCGCAGCGGTACAAAAGTATCTTGCGCACTTGCGAA

Full Affymetrix probeset data:

Annotations for 1628927_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime