Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628928_s_at:

>probe:Drosophila_2:1628928_s_at:533:199; Interrogation_Position=137; Antisense; AACGAAGTCGTGACGCGCGAGTGCA
>probe:Drosophila_2:1628928_s_at:420:433; Interrogation_Position=155; Antisense; GAGTGCACCATTCACTTGGCCAAGC
>probe:Drosophila_2:1628928_s_at:702:515; Interrogation_Position=180; Antisense; GTGTCCACAACATCGGCTTCAAGAA
>probe:Drosophila_2:1628928_s_at:41:225; Interrogation_Position=224; Antisense; AAGGAGATCCGCAAGTTCGCCGAGC
>probe:Drosophila_2:1628928_s_at:128:593; Interrogation_Position=255; Antisense; TGGGCACCACCGATGTGAGGATCGA
>probe:Drosophila_2:1628928_s_at:506:607; Interrogation_Position=270; Antisense; TGAGGATCGACACCCGTCTGAACAA
>probe:Drosophila_2:1628928_s_at:627:385; Interrogation_Position=289; Antisense; GAACAAGCACATCTGGTCCAAGGGT
>probe:Drosophila_2:1628928_s_at:217:505; Interrogation_Position=304; Antisense; GTCCAAGGGTATCAGGTCCACTCCA
>probe:Drosophila_2:1628928_s_at:612:665; Interrogation_Position=392; Antisense; TACACTTACGTGACCTATGTGCCGG
>probe:Drosophila_2:1628928_s_at:238:63; Interrogation_Position=408; Antisense; ATGTGCCGGTGTCCACGTTCAAGAA
>probe:Drosophila_2:1628928_s_at:727:473; Interrogation_Position=424; Antisense; GTTCAAGAACTTGCAGACCGAGAAT
>probe:Drosophila_2:1628928_s_at:189:501; Interrogation_Position=449; Antisense; GTCGAGTCCAGCGACGACTAAGCAA
>probe:Drosophila_2:1628928_s_at:198:459; Interrogation_Position=59; Antisense; GATATTGAGTAGCACCGTTTCGGGC
>probe:Drosophila_2:1628928_s_at:192:131; Interrogation_Position=72; Antisense; ACCGTTTCGGGCTAAACAGCACAAT

Paste this into a BLAST search page for me
AACGAAGTCGTGACGCGCGAGTGCAGAGTGCACCATTCACTTGGCCAAGCGTGTCCACAACATCGGCTTCAAGAAAAGGAGATCCGCAAGTTCGCCGAGCTGGGCACCACCGATGTGAGGATCGATGAGGATCGACACCCGTCTGAACAAGAACAAGCACATCTGGTCCAAGGGTGTCCAAGGGTATCAGGTCCACTCCATACACTTACGTGACCTATGTGCCGGATGTGCCGGTGTCCACGTTCAAGAAGTTCAAGAACTTGCAGACCGAGAATGTCGAGTCCAGCGACGACTAAGCAAGATATTGAGTAGCACCGTTTCGGGCACCGTTTCGGGCTAAACAGCACAAT

Full Affymetrix probeset data:

Annotations for 1628928_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime