Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628930_at:

>probe:Drosophila_2:1628930_at:169:257; Interrogation_Position=1994; Antisense; CACACTATTGCACTGTTCAAATTGT
>probe:Drosophila_2:1628930_at:287:589; Interrogation_Position=2025; Antisense; TGGTTAAAAACATTCGTTCTCACGT
>probe:Drosophila_2:1628930_at:486:293; Interrogation_Position=2039; Antisense; CGTTCTCACGTTCCTACATATTTGA
>probe:Drosophila_2:1628930_at:400:249; Interrogation_Position=2095; Antisense; AATTGGCACAAAGCGCTTAATCTTT
>probe:Drosophila_2:1628930_at:410:79; Interrogation_Position=2142; Antisense; AGGTTTATGTTTGCAACTGGACAGA
>probe:Drosophila_2:1628930_at:328:539; Interrogation_Position=2188; Antisense; GGTTAGTTACACATTATTCCATTTA
>probe:Drosophila_2:1628930_at:619:273; Interrogation_Position=2255; Antisense; CTTGATTTAAATTCTTTGGCTCTCG
>probe:Drosophila_2:1628930_at:694:709; Interrogation_Position=2266; Antisense; TTCTTTGGCTCTCGAAATCAGTGCA
>probe:Drosophila_2:1628930_at:358:183; Interrogation_Position=2290; Antisense; AAAATGTCGCATCTTTTCGGTCAAA
>probe:Drosophila_2:1628930_at:294:255; Interrogation_Position=2368; Antisense; CAACAGTGCTGGACATTGTAAACAA
>probe:Drosophila_2:1628930_at:264:225; Interrogation_Position=2441; Antisense; AAGGCTTAATATTTCGCTGGCTGTA
>probe:Drosophila_2:1628930_at:338:695; Interrogation_Position=2452; Antisense; TTTCGCTGGCTGTAAGCGGCATATC
>probe:Drosophila_2:1628930_at:522:119; Interrogation_Position=2466; Antisense; AGCGGCATATCTAAAATTCTTTTGG
>probe:Drosophila_2:1628930_at:578:581; Interrogation_Position=2488; Antisense; TGGTTTCCTTCGTGAGTCCATTGAA

Paste this into a BLAST search page for me
CACACTATTGCACTGTTCAAATTGTTGGTTAAAAACATTCGTTCTCACGTCGTTCTCACGTTCCTACATATTTGAAATTGGCACAAAGCGCTTAATCTTTAGGTTTATGTTTGCAACTGGACAGAGGTTAGTTACACATTATTCCATTTACTTGATTTAAATTCTTTGGCTCTCGTTCTTTGGCTCTCGAAATCAGTGCAAAAATGTCGCATCTTTTCGGTCAAACAACAGTGCTGGACATTGTAAACAAAAGGCTTAATATTTCGCTGGCTGTATTTCGCTGGCTGTAAGCGGCATATCAGCGGCATATCTAAAATTCTTTTGGTGGTTTCCTTCGTGAGTCCATTGAA

Full Affymetrix probeset data:

Annotations for 1628930_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime