FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628931_at:

>probe:Drosophila_2:1628931_at:408:241; Interrogation_Position=835; Antisense; AATACACCCAAGGTCGCTCTTTTAT
>probe:Drosophila_2:1628931_at:209:223; Interrogation_Position=844; Antisense; AAGGTCGCTCTTTTATCTCAACATG
>probe:Drosophila_2:1628931_at:76:503; Interrogation_Position=847; Antisense; GTCGCTCTTTTATCTCAACATGGAA
>probe:Drosophila_2:1628931_at:600:699; Interrogation_Position=855; Antisense; TTTATCTCAACATGGAAACCGGGCT
>probe:Drosophila_2:1628931_at:114:39; Interrogation_Position=858; Antisense; ATCTCAACATGGAAACCGGGCTCAA
>probe:Drosophila_2:1628931_at:250:651; Interrogation_Position=861; Antisense; TCAACATGGAAACCGGGCTCAACTG
>probe:Drosophila_2:1628931_at:721:337; Interrogation_Position=877; Antisense; GCTCAACTGGTTTTTGCTTACCCCA
>probe:Drosophila_2:1628931_at:173:639; Interrogation_Position=889; Antisense; TTTGCTTACCCCAACGTTCAAGACG
>probe:Drosophila_2:1628931_at:460:309; Interrogation_Position=899; Antisense; CCAACGTTCAAGACGCCTTTCTATT
>probe:Drosophila_2:1628931_at:302:645; Interrogation_Position=906; Antisense; TCAAGACGCCTTTCTATTAAACCCG
>probe:Drosophila_2:1628931_at:315:469; Interrogation_Position=934; Antisense; GTTCGTCGGGAACATTTTTAATGAT
>probe:Drosophila_2:1628931_at:310:363; Interrogation_Position=959; Antisense; GAATAATCCGGTATAAATCTTTATC
>probe:Drosophila_2:1628931_at:330:475; Interrogation_Position=969; Antisense; GTATAAATCTTTATCTACCCATTTT
>probe:Drosophila_2:1628931_at:289:641; Interrogation_Position=976; Antisense; TCTTTATCTACCCATTTTTAATAAG

Paste this into a BLAST search page for me
AATACACCCAAGGTCGCTCTTTTATAAGGTCGCTCTTTTATCTCAACATGGTCGCTCTTTTATCTCAACATGGAATTTATCTCAACATGGAAACCGGGCTATCTCAACATGGAAACCGGGCTCAATCAACATGGAAACCGGGCTCAACTGGCTCAACTGGTTTTTGCTTACCCCATTTGCTTACCCCAACGTTCAAGACGCCAACGTTCAAGACGCCTTTCTATTTCAAGACGCCTTTCTATTAAACCCGGTTCGTCGGGAACATTTTTAATGATGAATAATCCGGTATAAATCTTTATCGTATAAATCTTTATCTACCCATTTTTCTTTATCTACCCATTTTTAATAAG

Full Affymetrix probeset data:

Annotations for 1628931_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720