Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628932_at:

>probe:Drosophila_2:1628932_at:493:289; Interrogation_Position=1434; Antisense; CGGACAGCCATTCATCTTCGAGAAG
>probe:Drosophila_2:1628932_at:289:411; Interrogation_Position=1458; Antisense; GACGCTGAAACTGTCTTCGGGAGAG
>probe:Drosophila_2:1628932_at:199:717; Interrogation_Position=1492; Antisense; TTCTGGCGCTGCAACCAATGGTGGA
>probe:Drosophila_2:1628932_at:525:519; Interrogation_Position=1512; Antisense; GTGGAACCAAAAGTGTCGCTCGCGC
>probe:Drosophila_2:1628932_at:161:651; Interrogation_Position=1547; Antisense; TCAACGACGTTGTCTGTCCGCTTAA
>probe:Drosophila_2:1628932_at:293:465; Interrogation_Position=1641; Antisense; GATTGCCAAGGTGGTTGCCACAACA
>probe:Drosophila_2:1628932_at:324:359; Interrogation_Position=1701; Antisense; GCAACAAGAGATTCAGCTGACCAGC
>probe:Drosophila_2:1628932_at:47:607; Interrogation_Position=1752; Antisense; TGATGAATCCCCAGCTACAATCGAT
>probe:Drosophila_2:1628932_at:38:237; Interrogation_Position=1812; Antisense; AATCGTAGCGGATGTCACGGGCATT
>probe:Drosophila_2:1628932_at:259:355; Interrogation_Position=1844; Antisense; GCACGCGAGTGGTCAGTCGCCGAAA
>probe:Drosophila_2:1628932_at:382:465; Interrogation_Position=1874; Antisense; GATTGCTTTTTATTTTCTGACGTAA
>probe:Drosophila_2:1628932_at:200:451; Interrogation_Position=1899; Antisense; GATCGCAGATTCAGATTCCTTCTTT
>probe:Drosophila_2:1628932_at:185:711; Interrogation_Position=1946; Antisense; TTCATTTTTGAACTTGCCACGTCGA
>probe:Drosophila_2:1628932_at:424:719; Interrogation_Position=1959; Antisense; TTGCCACGTCGAAAACCAAGAGCCG

Paste this into a BLAST search page for me
CGGACAGCCATTCATCTTCGAGAAGGACGCTGAAACTGTCTTCGGGAGAGTTCTGGCGCTGCAACCAATGGTGGAGTGGAACCAAAAGTGTCGCTCGCGCTCAACGACGTTGTCTGTCCGCTTAAGATTGCCAAGGTGGTTGCCACAACAGCAACAAGAGATTCAGCTGACCAGCTGATGAATCCCCAGCTACAATCGATAATCGTAGCGGATGTCACGGGCATTGCACGCGAGTGGTCAGTCGCCGAAAGATTGCTTTTTATTTTCTGACGTAAGATCGCAGATTCAGATTCCTTCTTTTTCATTTTTGAACTTGCCACGTCGATTGCCACGTCGAAAACCAAGAGCCG

Full Affymetrix probeset data:

Annotations for 1628932_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime