FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628935_at:

>probe:Drosophila_2:1628935_at:164:539; Interrogation_Position=476; Antisense; GGTTATAAGCCAGATCCGGCGGATG
>probe:Drosophila_2:1628935_at:561:265; Interrogation_Position=486; Antisense; CAGATCCGGCGGATGAGAGCCTAAA
>probe:Drosophila_2:1628935_at:144:609; Interrogation_Position=499; Antisense; TGAGAGCCTAAATGCGTACACGCCC
>probe:Drosophila_2:1628935_at:119:665; Interrogation_Position=507; Antisense; TAAATGCGTACACGCCCAGCAAATT
>probe:Drosophila_2:1628935_at:3:667; Interrogation_Position=515; Antisense; TACACGCCCAGCAAATTTGCCCTGA
>probe:Drosophila_2:1628935_at:98:163; Interrogation_Position=527; Antisense; AAATTTGCCCTGACTGCCGTCCAGG
>probe:Drosophila_2:1628935_at:693:405; Interrogation_Position=538; Antisense; GACTGCCGTCCAGGAGATCTGCCGA
>probe:Drosophila_2:1628935_at:684:629; Interrogation_Position=546; Antisense; TCCAGGAGATCTGCCGACAGGAGCT
>probe:Drosophila_2:1628935_at:316:551; Interrogation_Position=550; Antisense; GGAGATCTGCCGACAGGAGCTAATC
>probe:Drosophila_2:1628935_at:481:39; Interrogation_Position=554; Antisense; ATCTGCCGACAGGAGCTAATCAATC
>probe:Drosophila_2:1628935_at:565:621; Interrogation_Position=557; Antisense; TGCCGACAGGAGCTAATCAATCAAG
>probe:Drosophila_2:1628935_at:211:553; Interrogation_Position=565; Antisense; GGAGCTAATCAATCAAGGATCAAAA
>probe:Drosophila_2:1628935_at:127:543; Interrogation_Position=581; Antisense; GGATCAAAAATTAAGACCACGAGCA
>probe:Drosophila_2:1628935_at:533:707; Interrogation_Position=591; Antisense; TTAAGACCACGAGCATCAATCCCGG

Paste this into a BLAST search page for me
GGTTATAAGCCAGATCCGGCGGATGCAGATCCGGCGGATGAGAGCCTAAATGAGAGCCTAAATGCGTACACGCCCTAAATGCGTACACGCCCAGCAAATTTACACGCCCAGCAAATTTGCCCTGAAAATTTGCCCTGACTGCCGTCCAGGGACTGCCGTCCAGGAGATCTGCCGATCCAGGAGATCTGCCGACAGGAGCTGGAGATCTGCCGACAGGAGCTAATCATCTGCCGACAGGAGCTAATCAATCTGCCGACAGGAGCTAATCAATCAAGGGAGCTAATCAATCAAGGATCAAAAGGATCAAAAATTAAGACCACGAGCATTAAGACCACGAGCATCAATCCCGG

Full Affymetrix probeset data:

Annotations for 1628935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720