FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628938_at:

>probe:Drosophila_2:1628938_at:594:5; Interrogation_Position=3585; Antisense; ATTGTCGCCTGATTTTGTGCAGTCC
>probe:Drosophila_2:1628938_at:557:471; Interrogation_Position=3612; Antisense; GTTCGGCGTTCAGGGTCTTCAGCAA
>probe:Drosophila_2:1628938_at:646:657; Interrogation_Position=3654; Antisense; TAACATTGTTCCAGAAACGCCGCTG
>probe:Drosophila_2:1628938_at:149:345; Interrogation_Position=3686; Antisense; GCATACACGGCATCCTAGAGCAGAT
>probe:Drosophila_2:1628938_at:32:555; Interrogation_Position=3717; Antisense; GGAGCGCTCGCGATACATGAGGATA
>probe:Drosophila_2:1628938_at:282:603; Interrogation_Position=3776; Antisense; TGTTCCGACACTTCCTCGTGGAGGA
>probe:Drosophila_2:1628938_at:672:263; Interrogation_Position=3822; Antisense; CAGCTACGTGGATTTCCTGTGTCAC
>probe:Drosophila_2:1628938_at:117:39; Interrogation_Position=3866; Antisense; ATCTGCTGAGTTAGCACGCCGGCTA
>probe:Drosophila_2:1628938_at:166:523; Interrogation_Position=3920; Antisense; GGGCGGACAGTTATTCCCAAAACAG
>probe:Drosophila_2:1628938_at:433:187; Interrogation_Position=3940; Antisense; AACAGGGCTCGGATGCGTCGTCTGT
>probe:Drosophila_2:1628938_at:438:51; Interrogation_Position=3970; Antisense; ATGCGCAGTCGCCTCGGAAAATAAG
>probe:Drosophila_2:1628938_at:90:197; Interrogation_Position=4025; Antisense; AACTGGCGCTGAAAGCTGTTGGAAC
>probe:Drosophila_2:1628938_at:158:657; Interrogation_Position=4093; Antisense; TAATGGCTATCATTTCGAGCGTATC
>probe:Drosophila_2:1628938_at:329:293; Interrogation_Position=4108; Antisense; CGAGCGTATCAATTCTTCCATTAAT

Paste this into a BLAST search page for me
ATTGTCGCCTGATTTTGTGCAGTCCGTTCGGCGTTCAGGGTCTTCAGCAATAACATTGTTCCAGAAACGCCGCTGGCATACACGGCATCCTAGAGCAGATGGAGCGCTCGCGATACATGAGGATATGTTCCGACACTTCCTCGTGGAGGACAGCTACGTGGATTTCCTGTGTCACATCTGCTGAGTTAGCACGCCGGCTAGGGCGGACAGTTATTCCCAAAACAGAACAGGGCTCGGATGCGTCGTCTGTATGCGCAGTCGCCTCGGAAAATAAGAACTGGCGCTGAAAGCTGTTGGAACTAATGGCTATCATTTCGAGCGTATCCGAGCGTATCAATTCTTCCATTAAT

Full Affymetrix probeset data:

Annotations for 1628938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720