FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628940_at:

>probe:Drosophila_2:1628940_at:287:25; Interrogation_Position=101; Antisense; ATAGTGGCGGTGACATTGACGAGTC
>probe:Drosophila_2:1628940_at:253:401; Interrogation_Position=112; Antisense; GACATTGACGAGTCCGCCTGGGCGT
>probe:Drosophila_2:1628940_at:9:651; Interrogation_Position=144; Antisense; TCAGCCGGCAGGCTGCGACAAATTT
>probe:Drosophila_2:1628940_at:688:519; Interrogation_Position=15; Antisense; GTGGACGCTGCAGATAAAGTTTGTG
>probe:Drosophila_2:1628940_at:196:573; Interrogation_Position=154; Antisense; GGCTGCGACAAATTTGGACCCAGAA
>probe:Drosophila_2:1628940_at:561:263; Interrogation_Position=187; Antisense; CAGATAAACCGGACCCCGACACATA
>probe:Drosophila_2:1628940_at:362:397; Interrogation_Position=204; Antisense; GACACATACGGGTCCCTGCAAGTAC
>probe:Drosophila_2:1628940_at:234:141; Interrogation_Position=211; Antisense; ACGGGTCCCTGCAAGTACCATAGAA
>probe:Drosophila_2:1628940_at:430:487; Interrogation_Position=225; Antisense; GTACCATAGAACCAAGGTCTTCCAC
>probe:Drosophila_2:1628940_at:565:249; Interrogation_Position=237; Antisense; CAAGGTCTTCCACCTCACGAAGTAA
>probe:Drosophila_2:1628940_at:487:663; Interrogation_Position=29; Antisense; TAAAGTTTGTGCAGCGCCGGGATCA
>probe:Drosophila_2:1628940_at:391:123; Interrogation_Position=41; Antisense; AGCGCCGGGATCACGGCATGTACGA
>probe:Drosophila_2:1628940_at:703:347; Interrogation_Position=56; Antisense; GCATGTACGAGTGCCAGTCCGATTG
>probe:Drosophila_2:1628940_at:300:669; Interrogation_Position=61; Antisense; TACGAGTGCCAGTCCGATTGGGAGT

Paste this into a BLAST search page for me
ATAGTGGCGGTGACATTGACGAGTCGACATTGACGAGTCCGCCTGGGCGTTCAGCCGGCAGGCTGCGACAAATTTGTGGACGCTGCAGATAAAGTTTGTGGGCTGCGACAAATTTGGACCCAGAACAGATAAACCGGACCCCGACACATAGACACATACGGGTCCCTGCAAGTACACGGGTCCCTGCAAGTACCATAGAAGTACCATAGAACCAAGGTCTTCCACCAAGGTCTTCCACCTCACGAAGTAATAAAGTTTGTGCAGCGCCGGGATCAAGCGCCGGGATCACGGCATGTACGAGCATGTACGAGTGCCAGTCCGATTGTACGAGTGCCAGTCCGATTGGGAGT

Full Affymetrix probeset data:

Annotations for 1628940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720