Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628942_at:

>probe:Drosophila_2:1628942_at:512:101; Interrogation_Position=2050; Antisense; AGAGCACTATGTCCAGTCTTATCCC
>probe:Drosophila_2:1628942_at:578:677; Interrogation_Position=2057; Antisense; TATGTCCAGTCTTATCCCGAACTGG
>probe:Drosophila_2:1628942_at:641:633; Interrogation_Position=2071; Antisense; TCCCGAACTGGAAACGACCGCTTAT
>probe:Drosophila_2:1628942_at:420:411; Interrogation_Position=2086; Antisense; GACCGCTTATTAGCGATGTTATCTA
>probe:Drosophila_2:1628942_at:403:619; Interrogation_Position=2131; Antisense; TGCATTCAACTTGTTGATCCACAAA
>probe:Drosophila_2:1628942_at:95:467; Interrogation_Position=2143; Antisense; GTTGATCCACAAATCGAAAACGATA
>probe:Drosophila_2:1628942_at:557:31; Interrogation_Position=2171; Antisense; ATCAATGGAGCACTTGTTAGACTAT
>probe:Drosophila_2:1628942_at:131:473; Interrogation_Position=2186; Antisense; GTTAGACTATAAGAACCTCTTTCTA
>probe:Drosophila_2:1628942_at:457:141; Interrogation_Position=2224; Antisense; ACGGAAATGAAACTTGATGTCGCAA
>probe:Drosophila_2:1628942_at:407:357; Interrogation_Position=2245; Antisense; GCAAACATATCAGCTTTTTGAAGTT
>probe:Drosophila_2:1628942_at:9:301; Interrogation_Position=2295; Antisense; CCCTTCCACAAATTTTAGCATTTAT
>probe:Drosophila_2:1628942_at:173:385; Interrogation_Position=2358; Antisense; GAACTCTAGGAAGATGCGAATTTTT
>probe:Drosophila_2:1628942_at:74:685; Interrogation_Position=2519; Antisense; TATCCATCTGGAAACAACACAAAAA
>probe:Drosophila_2:1628942_at:518:391; Interrogation_Position=2547; Antisense; GAAACGCAAACATATCATGCCCAAA

Paste this into a BLAST search page for me
AGAGCACTATGTCCAGTCTTATCCCTATGTCCAGTCTTATCCCGAACTGGTCCCGAACTGGAAACGACCGCTTATGACCGCTTATTAGCGATGTTATCTATGCATTCAACTTGTTGATCCACAAAGTTGATCCACAAATCGAAAACGATAATCAATGGAGCACTTGTTAGACTATGTTAGACTATAAGAACCTCTTTCTAACGGAAATGAAACTTGATGTCGCAAGCAAACATATCAGCTTTTTGAAGTTCCCTTCCACAAATTTTAGCATTTATGAACTCTAGGAAGATGCGAATTTTTTATCCATCTGGAAACAACACAAAAAGAAACGCAAACATATCATGCCCAAA

Full Affymetrix probeset data:

Annotations for 1628942_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime