Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628943_at:

>probe:Drosophila_2:1628943_at:339:233; Interrogation_Position=2294; Antisense; AATGCCTACATCAATCTGCTGACCT
>probe:Drosophila_2:1628943_at:326:47; Interrogation_Position=2319; Antisense; ATGCCCAACAACTGTACGGTCGCAA
>probe:Drosophila_2:1628943_at:579:713; Interrogation_Position=2357; Antisense; TTCAGTTTCAGCATGTTCTCCTCGC
>probe:Drosophila_2:1628943_at:100:301; Interrogation_Position=2379; Antisense; CGCCGATCGGGCACTATGATCTGAT
>probe:Drosophila_2:1628943_at:235:683; Interrogation_Position=2393; Antisense; TATGATCTGATCTTCCAGGACGCCA
>probe:Drosophila_2:1628943_at:414:119; Interrogation_Position=2424; Antisense; AGCTGCAAGTAATTCCGCCCAATAA
>probe:Drosophila_2:1628943_at:318:353; Interrogation_Position=2472; Antisense; GCAGCGATTTTATGCGAGCACGCCG
>probe:Drosophila_2:1628943_at:437:95; Interrogation_Position=2526; Antisense; AGTTGGCATTATCCGTGGGCCTGCT
>probe:Drosophila_2:1628943_at:578:529; Interrogation_Position=2557; Antisense; GGGTTCGCTGGTTGCAATGCTCTAA
>probe:Drosophila_2:1628943_at:475:233; Interrogation_Position=2572; Antisense; AATGCTCTAAGCCACTAGACTCACT
>probe:Drosophila_2:1628943_at:370:661; Interrogation_Position=2676; Antisense; TAAATGTGAAATCCCTTCCGTCCGA
>probe:Drosophila_2:1628943_at:208:171; Interrogation_Position=2758; Antisense; AAAGTCCTGTGCCTTATTATAGTAT
>probe:Drosophila_2:1628943_at:469:489; Interrogation_Position=2791; Antisense; GTACATACCAACTAAGACCGTCCAA
>probe:Drosophila_2:1628943_at:317:319; Interrogation_Position=2838; Antisense; GCCGAATCTTTTACAACCGCTTATG

Paste this into a BLAST search page for me
AATGCCTACATCAATCTGCTGACCTATGCCCAACAACTGTACGGTCGCAATTCAGTTTCAGCATGTTCTCCTCGCCGCCGATCGGGCACTATGATCTGATTATGATCTGATCTTCCAGGACGCCAAGCTGCAAGTAATTCCGCCCAATAAGCAGCGATTTTATGCGAGCACGCCGAGTTGGCATTATCCGTGGGCCTGCTGGGTTCGCTGGTTGCAATGCTCTAAAATGCTCTAAGCCACTAGACTCACTTAAATGTGAAATCCCTTCCGTCCGAAAAGTCCTGTGCCTTATTATAGTATGTACATACCAACTAAGACCGTCCAAGCCGAATCTTTTACAACCGCTTATG

Full Affymetrix probeset data:

Annotations for 1628943_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime