FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628945_at:

>probe:Drosophila_2:1628945_at:79:423; Interrogation_Position=1046; Antisense; GAGACAGAGCTGACGGAACCTTCCT
>probe:Drosophila_2:1628945_at:474:297; Interrogation_Position=1080; Antisense; CGCCGCAGAGTAACCCCGAAGGAAT
>probe:Drosophila_2:1628945_at:575:371; Interrogation_Position=1097; Antisense; GAAGGAATCCCTGCACCAGAGCGAT
>probe:Drosophila_2:1628945_at:725:101; Interrogation_Position=1114; Antisense; AGAGCGATTTCGACTTACCGCCGAC
>probe:Drosophila_2:1628945_at:323:723; Interrogation_Position=1164; Antisense; TTGACAGCCATCTGTCGCACATTTA
>probe:Drosophila_2:1628945_at:82:149; Interrogation_Position=1182; Antisense; ACATTTATCCCGTCTACTGGGCACG
>probe:Drosophila_2:1628945_at:639:297; Interrogation_Position=1205; Antisense; CGCACGCGTGCGATTTTAATCCAAC
>probe:Drosophila_2:1628945_at:76:657; Interrogation_Position=1221; Antisense; TAATCCAACAGGCACGTGAGCGACT
>probe:Drosophila_2:1628945_at:61:609; Interrogation_Position=1237; Antisense; TGAGCGACTCGTGTGCGGATTCGAC
>probe:Drosophila_2:1628945_at:398:537; Interrogation_Position=1253; Antisense; GGATTCGACGGCAGTTTGGTTCGCT
>probe:Drosophila_2:1628945_at:176:343; Interrogation_Position=1275; Antisense; GCTTCGAGCAGCGATTCCTATGCAA
>probe:Drosophila_2:1628945_at:369:355; Interrogation_Position=1326; Antisense; GCACGGCCCATCAAATTGGCGAGGT
>probe:Drosophila_2:1628945_at:261:413; Interrogation_Position=805; Antisense; GACCACCATCACACTGATCAGGAAT
>probe:Drosophila_2:1628945_at:56:481; Interrogation_Position=966; Antisense; GTTTGAGTGCCAGCATTGCCGAGGA

Paste this into a BLAST search page for me
GAGACAGAGCTGACGGAACCTTCCTCGCCGCAGAGTAACCCCGAAGGAATGAAGGAATCCCTGCACCAGAGCGATAGAGCGATTTCGACTTACCGCCGACTTGACAGCCATCTGTCGCACATTTAACATTTATCCCGTCTACTGGGCACGCGCACGCGTGCGATTTTAATCCAACTAATCCAACAGGCACGTGAGCGACTTGAGCGACTCGTGTGCGGATTCGACGGATTCGACGGCAGTTTGGTTCGCTGCTTCGAGCAGCGATTCCTATGCAAGCACGGCCCATCAAATTGGCGAGGTGACCACCATCACACTGATCAGGAATGTTTGAGTGCCAGCATTGCCGAGGA

Full Affymetrix probeset data:

Annotations for 1628945_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720