Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628946_at:

>probe:Drosophila_2:1628946_at:633:207; Interrogation_Position=1821; Antisense; AAGCTCCAAGCAGCTATGTCTCCAA
>probe:Drosophila_2:1628946_at:532:677; Interrogation_Position=1835; Antisense; TATGTCTCCAACTCGAGCCAAACTC
>probe:Drosophila_2:1628946_at:673:449; Interrogation_Position=1906; Antisense; GATCCGCGACTATTGGTACGAGCTC
>probe:Drosophila_2:1628946_at:409:729; Interrogation_Position=1918; Antisense; TTGGTACGAGCTCAAGTTCTCCGAC
>probe:Drosophila_2:1628946_at:39:473; Interrogation_Position=1933; Antisense; GTTCTCCGACCTATTCAAGTTCATA
>probe:Drosophila_2:1628946_at:268:547; Interrogation_Position=1963; Antisense; GGATGGACGTTACCAGTGCCCCAGA
>probe:Drosophila_2:1628946_at:461:505; Interrogation_Position=1978; Antisense; GTGCCCCAGATTCAATTGCCTGAAG
>probe:Drosophila_2:1628946_at:591:213; Interrogation_Position=2000; Antisense; AAGAGCTACAAGGACGCCAGCTCGC
>probe:Drosophila_2:1628946_at:332:119; Interrogation_Position=2018; Antisense; AGCTCGCTGCAACGACATATCAGAT
>probe:Drosophila_2:1628946_at:589:163; Interrogation_Position=2063; Antisense; AAATTTCGCTGTCTGATGTGCGGCA
>probe:Drosophila_2:1628946_at:100:443; Interrogation_Position=2077; Antisense; GATGTGCGGCAAAGCATTTTCACAA
>probe:Drosophila_2:1628946_at:252:15; Interrogation_Position=2092; Antisense; ATTTTCACAAAGCTCCCACCTAAAG
>probe:Drosophila_2:1628946_at:551:129; Interrogation_Position=2109; Antisense; ACCTAAAGCGACACCTTGAGAGCGG
>probe:Drosophila_2:1628946_at:23:419; Interrogation_Position=2128; Antisense; GAGCGGTGTCTGTGTCAAATATTAC

Paste this into a BLAST search page for me
AAGCTCCAAGCAGCTATGTCTCCAATATGTCTCCAACTCGAGCCAAACTCGATCCGCGACTATTGGTACGAGCTCTTGGTACGAGCTCAAGTTCTCCGACGTTCTCCGACCTATTCAAGTTCATAGGATGGACGTTACCAGTGCCCCAGAGTGCCCCAGATTCAATTGCCTGAAGAAGAGCTACAAGGACGCCAGCTCGCAGCTCGCTGCAACGACATATCAGATAAATTTCGCTGTCTGATGTGCGGCAGATGTGCGGCAAAGCATTTTCACAAATTTTCACAAAGCTCCCACCTAAAGACCTAAAGCGACACCTTGAGAGCGGGAGCGGTGTCTGTGTCAAATATTAC

Full Affymetrix probeset data:

Annotations for 1628946_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime