FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628949_at:

>probe:Drosophila_2:1628949_at:41:311; Interrogation_Position=102; Antisense; GCCACGAATTGGCATCAGCATCTCG
>probe:Drosophila_2:1628949_at:276:249; Interrogation_Position=108; Antisense; AATTGGCATCAGCATCTCGAGGAAT
>probe:Drosophila_2:1628949_at:658:569; Interrogation_Position=112; Antisense; GGCATCAGCATCTCGAGGAATCTAC
>probe:Drosophila_2:1628949_at:190:79; Interrogation_Position=185; Antisense; AGGATATAGGAATGACCTTCACGGG
>probe:Drosophila_2:1628949_at:697:645; Interrogation_Position=203; Antisense; TCACGGGGTCTACGGGTATCAATAA
>probe:Drosophila_2:1628949_at:83:3; Interrogation_Position=41; Antisense; ATCGGAACGGAAAGATTTTCATCGG
>probe:Drosophila_2:1628949_at:187:461; Interrogation_Position=54; Antisense; GATTTTCATCGGAAACGGTGTATTT
>probe:Drosophila_2:1628949_at:657:175; Interrogation_Position=66; Antisense; AAACGGTGTATTTCTGGTGCCTTCA
>probe:Drosophila_2:1628949_at:265:141; Interrogation_Position=68; Antisense; ACGGTGTATTTCTGGTGCCTTCATT
>probe:Drosophila_2:1628949_at:284:19; Interrogation_Position=75; Antisense; ATTTCTGGTGCCTTCATTGGGAATT
>probe:Drosophila_2:1628949_at:401:591; Interrogation_Position=80; Antisense; TGGTGCCTTCATTGGGAATTTCGCC
>probe:Drosophila_2:1628949_at:410:315; Interrogation_Position=84; Antisense; GCCTTCATTGGGAATTTCGCCACGA
>probe:Drosophila_2:1628949_at:289:713; Interrogation_Position=87; Antisense; TTCATTGGGAATTTCGCCACGAATT
>probe:Drosophila_2:1628949_at:115:365; Interrogation_Position=95; Antisense; GAATTTCGCCACGAATTGGCATCAG

Paste this into a BLAST search page for me
GCCACGAATTGGCATCAGCATCTCGAATTGGCATCAGCATCTCGAGGAATGGCATCAGCATCTCGAGGAATCTACAGGATATAGGAATGACCTTCACGGGTCACGGGGTCTACGGGTATCAATAAATCGGAACGGAAAGATTTTCATCGGGATTTTCATCGGAAACGGTGTATTTAAACGGTGTATTTCTGGTGCCTTCAACGGTGTATTTCTGGTGCCTTCATTATTTCTGGTGCCTTCATTGGGAATTTGGTGCCTTCATTGGGAATTTCGCCGCCTTCATTGGGAATTTCGCCACGATTCATTGGGAATTTCGCCACGAATTGAATTTCGCCACGAATTGGCATCAG

Full Affymetrix probeset data:

Annotations for 1628949_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720