FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628950_at:

>probe:Drosophila_2:1628950_at:138:383; Interrogation_Position=1017; Antisense; GAACGATTCCATTGGTGATCTGCCC
>probe:Drosophila_2:1628950_at:472:513; Interrogation_Position=1031; Antisense; GTGATCTGCCCTCGAATGTGATGAT
>probe:Drosophila_2:1628950_at:645:63; Interrogation_Position=1062; Antisense; ATGGATGCCCCAGAACGACATTTTG
>probe:Drosophila_2:1628950_at:547:381; Interrogation_Position=1074; Antisense; GAACGACATTTTGGCCCATCCGAAT
>probe:Drosophila_2:1628950_at:281:651; Interrogation_Position=1112; Antisense; TCACGCACGGCGGTATTTTTGGAAC
>probe:Drosophila_2:1628950_at:397:545; Interrogation_Position=1188; Antisense; GGATCAGCACCGGAACACTATTAAA
>probe:Drosophila_2:1628950_at:289:83; Interrogation_Position=1223; Antisense; AGGGCTATGCCCGATCGCTGGTGTT
>probe:Drosophila_2:1628950_at:545:601; Interrogation_Position=1244; Antisense; TGTTCTCCAAACTCACCACTGATGA
>probe:Drosophila_2:1628950_at:566:533; Interrogation_Position=1272; Antisense; GGTGCGGAATATCGAGACTCTGATC
>probe:Drosophila_2:1628950_at:60:199; Interrogation_Position=1297; Antisense; AACGATCCCCAGTACAAGCGCAGTG
>probe:Drosophila_2:1628950_at:664:507; Interrogation_Position=1319; Antisense; GTGCTCTGGAGGTATCGCAGCGATT
>probe:Drosophila_2:1628950_at:559:655; Interrogation_Position=1350; Antisense; TAATCCCATACATCCGCTGGACGAG
>probe:Drosophila_2:1628950_at:146:313; Interrogation_Position=1375; Antisense; GCCACCTTCTGGATCGAGTACATAA
>probe:Drosophila_2:1628950_at:91:527; Interrogation_Position=1562; Antisense; GGGAATCCTCTAACAAACTGAACGA

Paste this into a BLAST search page for me
GAACGATTCCATTGGTGATCTGCCCGTGATCTGCCCTCGAATGTGATGATATGGATGCCCCAGAACGACATTTTGGAACGACATTTTGGCCCATCCGAATTCACGCACGGCGGTATTTTTGGAACGGATCAGCACCGGAACACTATTAAAAGGGCTATGCCCGATCGCTGGTGTTTGTTCTCCAAACTCACCACTGATGAGGTGCGGAATATCGAGACTCTGATCAACGATCCCCAGTACAAGCGCAGTGGTGCTCTGGAGGTATCGCAGCGATTTAATCCCATACATCCGCTGGACGAGGCCACCTTCTGGATCGAGTACATAAGGGAATCCTCTAACAAACTGAACGA

Full Affymetrix probeset data:

Annotations for 1628950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720