FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628951_at:

>probe:Drosophila_2:1628951_at:490:117; Interrogation_Position=3814; Antisense; AGCTATCGGGAGACACTGAGCGCCT
>probe:Drosophila_2:1628951_at:384:173; Interrogation_Position=3851; Antisense; AAAGCTTCATCGGAGACGCCAGTGC
>probe:Drosophila_2:1628951_at:561:683; Interrogation_Position=3944; Antisense; TATCCACAGTTGTGCCTGGGTCAAG
>probe:Drosophila_2:1628951_at:637:205; Interrogation_Position=4039; Antisense; AAGCGACCCAGCTTCGAGAGGAAGT
>probe:Drosophila_2:1628951_at:423:99; Interrogation_Position=4055; Antisense; AGAGGAAGTCCTCGCTGACGTACGA
>probe:Drosophila_2:1628951_at:217:409; Interrogation_Position=4071; Antisense; GACGTACGACCACGAGCTGAGCGAT
>probe:Drosophila_2:1628951_at:58:611; Interrogation_Position=4163; Antisense; TGACCGGAGGCTCGCACAAACTGAA
>probe:Drosophila_2:1628951_at:621:219; Interrogation_Position=4192; Antisense; AAGTCGCTGAGCGATGACACCGACG
>probe:Drosophila_2:1628951_at:340:55; Interrogation_Position=4220; Antisense; ATGAAGCGGCGGATCGCAAGCGCAA
>probe:Drosophila_2:1628951_at:524:205; Interrogation_Position=4237; Antisense; AAGCGCAAGCGGATCGTCTGCATTG
>probe:Drosophila_2:1628951_at:387:5; Interrogation_Position=4258; Antisense; ATTGTCCTGTCCACGGTCCTGTTGT
>probe:Drosophila_2:1628951_at:454:477; Interrogation_Position=4300; Antisense; GTTTTTGTGCTGACCATCACGCTGA
>probe:Drosophila_2:1628951_at:25:577; Interrogation_Position=4353; Antisense; GGCGCATTCGTTCAGTAGGGACACC
>probe:Drosophila_2:1628951_at:197:275; Interrogation_Position=4384; Antisense; CATTGGACGGGCATGAGGCCCTCAT

Paste this into a BLAST search page for me
AGCTATCGGGAGACACTGAGCGCCTAAAGCTTCATCGGAGACGCCAGTGCTATCCACAGTTGTGCCTGGGTCAAGAAGCGACCCAGCTTCGAGAGGAAGTAGAGGAAGTCCTCGCTGACGTACGAGACGTACGACCACGAGCTGAGCGATTGACCGGAGGCTCGCACAAACTGAAAAGTCGCTGAGCGATGACACCGACGATGAAGCGGCGGATCGCAAGCGCAAAAGCGCAAGCGGATCGTCTGCATTGATTGTCCTGTCCACGGTCCTGTTGTGTTTTTGTGCTGACCATCACGCTGAGGCGCATTCGTTCAGTAGGGACACCCATTGGACGGGCATGAGGCCCTCAT

Full Affymetrix probeset data:

Annotations for 1628951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720