FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628953_at:

>probe:Drosophila_2:1628953_at:537:11; Interrogation_Position=1458; Antisense; ATTCTGCCGGAACGAGGGACCCATG
>probe:Drosophila_2:1628953_at:36:179; Interrogation_Position=1501; Antisense; AAACTCAGCTACTTGCCGAACTGTG
>probe:Drosophila_2:1628953_at:193:285; Interrogation_Position=1573; Antisense; CGGCCAACCGGACCTATTGAGAAGT
>probe:Drosophila_2:1628953_at:330:107; Interrogation_Position=1607; Antisense; AGAAACTTAGCTACGGACCGCCAGG
>probe:Drosophila_2:1628953_at:389:435; Interrogation_Position=1649; Antisense; GAGGTCCTTGTGGAACTGGCGCTAA
>probe:Drosophila_2:1628953_at:509:195; Interrogation_Position=1662; Antisense; AACTGGCGCTAACGATGGCACCTTT
>probe:Drosophila_2:1628953_at:706:255; Interrogation_Position=1689; Antisense; CAAAGCCGGCATTTGTTAGCCTGGA
>probe:Drosophila_2:1628953_at:126:721; Interrogation_Position=1726; Antisense; TTGCTCTGAAGAATCCGTCTCCCAA
>probe:Drosophila_2:1628953_at:334:339; Interrogation_Position=1751; Antisense; GCTCATCCCGAGTTCTACGTTTTAT
>probe:Drosophila_2:1628953_at:564:207; Interrogation_Position=1780; Antisense; AAGCTAAATCTTTCAGTCCACGTCT
>probe:Drosophila_2:1628953_at:179:719; Interrogation_Position=1850; Antisense; TTCGCTTTGCGAACTGCATCCATTA
>probe:Drosophila_2:1628953_at:497:347; Interrogation_Position=1865; Antisense; GCATCCATTAATCGAGCGGCGCTAT
>probe:Drosophila_2:1628953_at:341:617; Interrogation_Position=1903; Antisense; TGCACCATCGCTTTTATCCGATTTT
>probe:Drosophila_2:1628953_at:628:7; Interrogation_Position=1954; Antisense; ATTGCCGGTGATCCAATACATGGCT

Paste this into a BLAST search page for me
ATTCTGCCGGAACGAGGGACCCATGAAACTCAGCTACTTGCCGAACTGTGCGGCCAACCGGACCTATTGAGAAGTAGAAACTTAGCTACGGACCGCCAGGGAGGTCCTTGTGGAACTGGCGCTAAAACTGGCGCTAACGATGGCACCTTTCAAAGCCGGCATTTGTTAGCCTGGATTGCTCTGAAGAATCCGTCTCCCAAGCTCATCCCGAGTTCTACGTTTTATAAGCTAAATCTTTCAGTCCACGTCTTTCGCTTTGCGAACTGCATCCATTAGCATCCATTAATCGAGCGGCGCTATTGCACCATCGCTTTTATCCGATTTTATTGCCGGTGATCCAATACATGGCT

Full Affymetrix probeset data:

Annotations for 1628953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720