FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628954_at:

>probe:Drosophila_2:1628954_at:610:73; Interrogation_Position=3332; Antisense; AGGACCCGGTGCTCTTCTCGGGATC
>probe:Drosophila_2:1628954_at:98:549; Interrogation_Position=3417; Antisense; GGAGGCCGTCAAGCTCAAGGAGTTC
>probe:Drosophila_2:1628954_at:287:77; Interrogation_Position=3455; Antisense; AGGATGGCATCAACTGCAGGCTCCA
>probe:Drosophila_2:1628954_at:12:121; Interrogation_Position=3515; Antisense; AGCTGGTCTGTCTGGCCAGAGCCCT
>probe:Drosophila_2:1628954_at:487:715; Interrogation_Position=3539; Antisense; TTCTGCGCCAGAACAAAATACTCAT
>probe:Drosophila_2:1628954_at:464:33; Interrogation_Position=3562; Antisense; ATCATGGACGAAGCCACAGCAAACG
>probe:Drosophila_2:1628954_at:25:111; Interrogation_Position=3579; Antisense; AGCAAACGTGGATCCCGAGACCGAC
>probe:Drosophila_2:1628954_at:538:103; Interrogation_Position=3596; Antisense; AGACCGACAATCTCATCCAGGAGGC
>probe:Drosophila_2:1628954_at:254:267; Interrogation_Position=3613; Antisense; CAGGAGGCGATCCACACCAAGTTCG
>probe:Drosophila_2:1628954_at:670:39; Interrogation_Position=3665; Antisense; ATCGGCTGCACACCGTTATGGACAA
>probe:Drosophila_2:1628954_at:477:701; Interrogation_Position=3680; Antisense; TTATGGACAACGACCGGGTGATGGT
>probe:Drosophila_2:1628954_at:415:137; Interrogation_Position=3743; Antisense; ACGAGCTGCTACACAACCGGCACGG
>probe:Drosophila_2:1628954_at:466:673; Interrogation_Position=3769; Antisense; TACCTGCACCGCTTCGTGGAGAAGA
>probe:Drosophila_2:1628954_at:559:545; Interrogation_Position=3880; Antisense; GGATCCGTGCTGGATCTGGGCTACA

Paste this into a BLAST search page for me
AGGACCCGGTGCTCTTCTCGGGATCGGAGGCCGTCAAGCTCAAGGAGTTCAGGATGGCATCAACTGCAGGCTCCAAGCTGGTCTGTCTGGCCAGAGCCCTTTCTGCGCCAGAACAAAATACTCATATCATGGACGAAGCCACAGCAAACGAGCAAACGTGGATCCCGAGACCGACAGACCGACAATCTCATCCAGGAGGCCAGGAGGCGATCCACACCAAGTTCGATCGGCTGCACACCGTTATGGACAATTATGGACAACGACCGGGTGATGGTACGAGCTGCTACACAACCGGCACGGTACCTGCACCGCTTCGTGGAGAAGAGGATCCGTGCTGGATCTGGGCTACA

Full Affymetrix probeset data:

Annotations for 1628954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720