FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628955_at:

>probe:Drosophila_2:1628955_at:567:273; Interrogation_Position=1786; Antisense; CATTAATATGTCTGCGGTGGGTCCG
>probe:Drosophila_2:1628955_at:382:41; Interrogation_Position=1848; Antisense; ATCGGAGGGTCCTGTGTGAGCCATC
>probe:Drosophila_2:1628955_at:76:47; Interrogation_Position=1870; Antisense; ATCCGCCTGGGACTTTTGCAATCGT
>probe:Drosophila_2:1628955_at:94:251; Interrogation_Position=1888; Antisense; CAATCGTCACGATTTCCGCGTTAAA
>probe:Drosophila_2:1628955_at:455:439; Interrogation_Position=1960; Antisense; GATGGCGCACATTCAGTACTTTCTG
>probe:Drosophila_2:1628955_at:40:91; Interrogation_Position=1974; Antisense; AGTACTTTCTGCAGTATCGTCACCT
>probe:Drosophila_2:1628955_at:708:495; Interrogation_Position=1992; Antisense; GTCACCTGCCCAAGATCTTCAGAAA
>probe:Drosophila_2:1628955_at:378:229; Interrogation_Position=2015; Antisense; AATGGAGCGAATCCGGCATTTCACC
>probe:Drosophila_2:1628955_at:706:597; Interrogation_Position=2064; Antisense; TGTCCGTATCAACTCCAAGGCATTT
>probe:Drosophila_2:1628955_at:576:617; Interrogation_Position=2088; Antisense; TGCAGACTCTGGGACTACTACAAAG
>probe:Drosophila_2:1628955_at:4:173; Interrogation_Position=2109; Antisense; AAAGATCCCTCGATGAGTCCAGCTA
>probe:Drosophila_2:1628955_at:692:659; Interrogation_Position=2140; Antisense; TAACTATCTGTTCACCATGGCCATT
>probe:Drosophila_2:1628955_at:303:273; Interrogation_Position=2190; Antisense; CATTATCTCTGGACAATTGGCGGTA
>probe:Drosophila_2:1628955_at:482:691; Interrogation_Position=2323; Antisense; TTTCGACCCGGGAGCCAAATACCAT

Paste this into a BLAST search page for me
CATTAATATGTCTGCGGTGGGTCCGATCGGAGGGTCCTGTGTGAGCCATCATCCGCCTGGGACTTTTGCAATCGTCAATCGTCACGATTTCCGCGTTAAAGATGGCGCACATTCAGTACTTTCTGAGTACTTTCTGCAGTATCGTCACCTGTCACCTGCCCAAGATCTTCAGAAAAATGGAGCGAATCCGGCATTTCACCTGTCCGTATCAACTCCAAGGCATTTTGCAGACTCTGGGACTACTACAAAGAAAGATCCCTCGATGAGTCCAGCTATAACTATCTGTTCACCATGGCCATTCATTATCTCTGGACAATTGGCGGTATTTCGACCCGGGAGCCAAATACCAT

Full Affymetrix probeset data:

Annotations for 1628955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720