Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628956_at:

>probe:Drosophila_2:1628956_at:117:117; Interrogation_Position=1099; Antisense; AGCCAGTCTGAATGTTGTAAACCGT
>probe:Drosophila_2:1628956_at:570:399; Interrogation_Position=1136; Antisense; GACTTTCGATTTCTAGACGTTTTGA
>probe:Drosophila_2:1628956_at:62:323; Interrogation_Position=1182; Antisense; GCGTACTAACATAAAGGCTACTTTT
>probe:Drosophila_2:1628956_at:127:691; Interrogation_Position=1208; Antisense; TTTGTTCACTATAAAACTGGCTTGA
>probe:Drosophila_2:1628956_at:657:487; Interrogation_Position=1244; Antisense; GTACTCGTTCATAAGTTGATTTTCC
>probe:Drosophila_2:1628956_at:293:461; Interrogation_Position=1261; Antisense; GATTTTCCTTGTAAATTTCGCTTGT
>probe:Drosophila_2:1628956_at:452:343; Interrogation_Position=1280; Antisense; GCTTGTAAACGCTTTTCTACGCATT
>probe:Drosophila_2:1628956_at:401:227; Interrogation_Position=1326; Antisense; AATCGAAGCGTTTACAAGCTAAAGC
>probe:Drosophila_2:1628956_at:313:681; Interrogation_Position=1399; Antisense; TATGAACCCGCGATAGATGCACAAA
>probe:Drosophila_2:1628956_at:130:3; Interrogation_Position=1442; Antisense; ATTGAACCAGTAAACCTCTTTATAG
>probe:Drosophila_2:1628956_at:528:401; Interrogation_Position=1488; Antisense; GACATTAACATTTAACTGCCAGCAG
>probe:Drosophila_2:1628956_at:481:659; Interrogation_Position=1500; Antisense; TAACTGCCAGCAGGGCGCGAAAAAT
>probe:Drosophila_2:1628956_at:431:357; Interrogation_Position=1527; Antisense; GCAAATGTTCGCTGAAGATTTACTT
>probe:Drosophila_2:1628956_at:620:477; Interrogation_Position=1596; Antisense; GTTTTAGTTTTCTTCATCTTACAAT

Paste this into a BLAST search page for me
AGCCAGTCTGAATGTTGTAAACCGTGACTTTCGATTTCTAGACGTTTTGAGCGTACTAACATAAAGGCTACTTTTTTTGTTCACTATAAAACTGGCTTGAGTACTCGTTCATAAGTTGATTTTCCGATTTTCCTTGTAAATTTCGCTTGTGCTTGTAAACGCTTTTCTACGCATTAATCGAAGCGTTTACAAGCTAAAGCTATGAACCCGCGATAGATGCACAAAATTGAACCAGTAAACCTCTTTATAGGACATTAACATTTAACTGCCAGCAGTAACTGCCAGCAGGGCGCGAAAAATGCAAATGTTCGCTGAAGATTTACTTGTTTTAGTTTTCTTCATCTTACAAT

Full Affymetrix probeset data:

Annotations for 1628956_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime