Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628957_at:

>probe:Drosophila_2:1628957_at:724:421; Interrogation_Position=1194; Antisense; GAGAATGATGAAGAGTTCGCCCATG
>probe:Drosophila_2:1628957_at:237:469; Interrogation_Position=1208; Antisense; GTTCGCCCATGTGAGTAACTTTCAG
>probe:Drosophila_2:1628957_at:173:659; Interrogation_Position=1223; Antisense; TAACTTTCAGGGAGCACAGCGAAGC
>probe:Drosophila_2:1628957_at:659:329; Interrogation_Position=1243; Antisense; GAAGCAGGTCGGTGGGAACCCTCTC
>probe:Drosophila_2:1628957_at:363:525; Interrogation_Position=1256; Antisense; GGGAACCCTCTCGAAATCCGAATGG
>probe:Drosophila_2:1628957_at:332:631; Interrogation_Position=1272; Antisense; TCCGAATGGGAAGCAGCAACTCTTT
>probe:Drosophila_2:1628957_at:495:359; Interrogation_Position=1287; Antisense; GCAACTCTTTATTTGGTTTGTGCCT
>probe:Drosophila_2:1628957_at:295:181; Interrogation_Position=1324; Antisense; AAAACACCTGGGACACCAATGGCAA
>probe:Drosophila_2:1628957_at:451:565; Interrogation_Position=1344; Antisense; GGCAAACCATTGTTCGAATTTGACG
>probe:Drosophila_2:1628957_at:235:365; Interrogation_Position=1359; Antisense; GAATTTGACGACTGATTATTGCCAA
>probe:Drosophila_2:1628957_at:388:675; Interrogation_Position=1398; Antisense; TAGACTATTATTCTGTACCCGTGGC
>probe:Drosophila_2:1628957_at:403:601; Interrogation_Position=1411; Antisense; TGTACCCGTGGCTTAGCACTTTTAA
>probe:Drosophila_2:1628957_at:610:671; Interrogation_Position=1482; Antisense; TAGCTCCGTAGGTTACAATTCGTAA
>probe:Drosophila_2:1628957_at:532:423; Interrogation_Position=1588; Antisense; GAGAAAGCCACCAACCATCAAGCTA

Paste this into a BLAST search page for me
GAGAATGATGAAGAGTTCGCCCATGGTTCGCCCATGTGAGTAACTTTCAGTAACTTTCAGGGAGCACAGCGAAGCGAAGCAGGTCGGTGGGAACCCTCTCGGGAACCCTCTCGAAATCCGAATGGTCCGAATGGGAAGCAGCAACTCTTTGCAACTCTTTATTTGGTTTGTGCCTAAAACACCTGGGACACCAATGGCAAGGCAAACCATTGTTCGAATTTGACGGAATTTGACGACTGATTATTGCCAATAGACTATTATTCTGTACCCGTGGCTGTACCCGTGGCTTAGCACTTTTAATAGCTCCGTAGGTTACAATTCGTAAGAGAAAGCCACCAACCATCAAGCTA

Full Affymetrix probeset data:

Annotations for 1628957_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime