Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628958_at:

>probe:Drosophila_2:1628958_at:475:269; Interrogation_Position=1062; Antisense; CATGGTATCGCTGGTGGCAATCTGC
>probe:Drosophila_2:1628958_at:276:565; Interrogation_Position=1077; Antisense; GGCAATCTGCGCGTGACATTAAACT
>probe:Drosophila_2:1628958_at:267:705; Interrogation_Position=1101; Antisense; TTATCCTGGAGAACCGACGACCGTT
>probe:Drosophila_2:1628958_at:228:205; Interrogation_Position=1135; Antisense; AAGCCGCTTTTTGCGGTCATTTCAA
>probe:Drosophila_2:1628958_at:468:729; Interrogation_Position=1160; Antisense; TTGGAGACGGTATCGACGACAGCCT
>probe:Drosophila_2:1628958_at:503:127; Interrogation_Position=1197; Antisense; ACCACGATCAGCAGGAAGCACCAGT
>probe:Drosophila_2:1628958_at:28:153; Interrogation_Position=1308; Antisense; ACAGTGAAGTCCTGGCCGCAGTAGT
>probe:Drosophila_2:1628958_at:281:483; Interrogation_Position=1328; Antisense; GTAGTGGCAGCCACCGTGGAATCGA
>probe:Drosophila_2:1628958_at:475:237; Interrogation_Position=1347; Antisense; AATCGATTGCTGACGCAAGTGCCCG
>probe:Drosophila_2:1628958_at:536:361; Interrogation_Position=1361; Antisense; GCAAGTGCCCGCGAGAGCGACAAAC
>probe:Drosophila_2:1628958_at:225:269; Interrogation_Position=1385; Antisense; CAGGACGAGGACTAGCAGCAGCATT
>probe:Drosophila_2:1628958_at:43:185; Interrogation_Position=1446; Antisense; AACTAAAGTACTGGACTGGGTCTCG
>probe:Drosophila_2:1628958_at:309:355; Interrogation_Position=1530; Antisense; GCAAGGATTTTGCTGGGCTTTCGTT
>probe:Drosophila_2:1628958_at:390:665; Interrogation_Position=1592; Antisense; TAAATTAACTTACTCTCTCTCGCGA

Paste this into a BLAST search page for me
CATGGTATCGCTGGTGGCAATCTGCGGCAATCTGCGCGTGACATTAAACTTTATCCTGGAGAACCGACGACCGTTAAGCCGCTTTTTGCGGTCATTTCAATTGGAGACGGTATCGACGACAGCCTACCACGATCAGCAGGAAGCACCAGTACAGTGAAGTCCTGGCCGCAGTAGTGTAGTGGCAGCCACCGTGGAATCGAAATCGATTGCTGACGCAAGTGCCCGGCAAGTGCCCGCGAGAGCGACAAACCAGGACGAGGACTAGCAGCAGCATTAACTAAAGTACTGGACTGGGTCTCGGCAAGGATTTTGCTGGGCTTTCGTTTAAATTAACTTACTCTCTCTCGCGA

Full Affymetrix probeset data:

Annotations for 1628958_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime