Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628959_at:

>probe:Drosophila_2:1628959_at:654:41; Interrogation_Position=1100; Antisense; ATCGAGTACGGCCATCGGGCAACAG
>probe:Drosophila_2:1628959_at:402:265; Interrogation_Position=1122; Antisense; CAGACGAGCGCAGCACGGAGCAATT
>probe:Drosophila_2:1628959_at:37:423; Interrogation_Position=1139; Antisense; GAGCAATTGTATGCCCTATCCAGGG
>probe:Drosophila_2:1628959_at:469:539; Interrogation_Position=1183; Antisense; GGTTAAGACACGCATACTCACTGGA
>probe:Drosophila_2:1628959_at:149:147; Interrogation_Position=1198; Antisense; ACTCACTGGAAACTTTCTGCTGCTG
>probe:Drosophila_2:1628959_at:498:535; Interrogation_Position=1261; Antisense; GGTGCGCCGCCTTATTGCAGAGGAC
>probe:Drosophila_2:1628959_at:579:251; Interrogation_Position=1290; Antisense; CAAGGGTGTTTGATTCCTCGGCCAA
>probe:Drosophila_2:1628959_at:670:213; Interrogation_Position=1314; Antisense; AAGAGGAGCGCGTGGACATCCTTCT
>probe:Drosophila_2:1628959_at:568:265; Interrogation_Position=1356; Antisense; CAGAGGCTCCGCTGTACAAGGACTT
>probe:Drosophila_2:1628959_at:111:607; Interrogation_Position=1389; Antisense; TGACCAACAGGGATCAGTGTGCCGT
>probe:Drosophila_2:1628959_at:663:189; Interrogation_Position=1439; Antisense; AACATGGCTGGAATTCCCGCCGTGT
>probe:Drosophila_2:1628959_at:616:721; Interrogation_Position=1493; Antisense; TTGCCCTTGAGCCTTCAGCTGATGA
>probe:Drosophila_2:1628959_at:257:351; Interrogation_Position=1534; Antisense; GCAGTTACTGCTCACAGTGGCACGA
>probe:Drosophila_2:1628959_at:545:583; Interrogation_Position=1575; Antisense; TGGAATTCGACAGCCTAGAGCACTC

Paste this into a BLAST search page for me
ATCGAGTACGGCCATCGGGCAACAGCAGACGAGCGCAGCACGGAGCAATTGAGCAATTGTATGCCCTATCCAGGGGGTTAAGACACGCATACTCACTGGAACTCACTGGAAACTTTCTGCTGCTGGGTGCGCCGCCTTATTGCAGAGGACCAAGGGTGTTTGATTCCTCGGCCAAAAGAGGAGCGCGTGGACATCCTTCTCAGAGGCTCCGCTGTACAAGGACTTTGACCAACAGGGATCAGTGTGCCGTAACATGGCTGGAATTCCCGCCGTGTTTGCCCTTGAGCCTTCAGCTGATGAGCAGTTACTGCTCACAGTGGCACGATGGAATTCGACAGCCTAGAGCACTC

Full Affymetrix probeset data:

Annotations for 1628959_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime