FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628962_at:

>probe:Drosophila_2:1628962_at:437:577; Interrogation_Position=1220; Antisense; GGCCAGGTCCGGATCCATAGCAGCT
>probe:Drosophila_2:1628962_at:527:109; Interrogation_Position=1252; Antisense; AGAAGATGCGCCACATCAGTCCGGA
>probe:Drosophila_2:1628962_at:361:51; Interrogation_Position=1257; Antisense; ATGCGCCACATCAGTCCGGACAGTG
>probe:Drosophila_2:1628962_at:78:85; Interrogation_Position=1278; Antisense; AGTGGGCACAATTCCACCAGCGACT
>probe:Drosophila_2:1628962_at:518:247; Interrogation_Position=1287; Antisense; AATTCCACCAGCGACTGCGAGCTGG
>probe:Drosophila_2:1628962_at:34:77; Interrogation_Position=1366; Antisense; AGGATGCCTGTCAGCTGGATGCCAT
>probe:Drosophila_2:1628962_at:345:649; Interrogation_Position=1376; Antisense; TCAGCTGGATGCCATGTGGTTGCAA
>probe:Drosophila_2:1628962_at:125:625; Interrogation_Position=1385; Antisense; TGCCATGTGGTTGCAAGTGCAGGCC
>probe:Drosophila_2:1628962_at:685:219; Interrogation_Position=1399; Antisense; AAGTGCAGGCCAGAGACGCCACGAA
>probe:Drosophila_2:1628962_at:584:101; Interrogation_Position=1410; Antisense; AGAGACGCCACGAAGAGACGCCTCA
>probe:Drosophila_2:1628962_at:628:637; Interrogation_Position=1432; Antisense; TCAGCTTCTCCCTGGTGGAAGAAAG
>probe:Drosophila_2:1628962_at:191:561; Interrogation_Position=1448; Antisense; GGAAGAAAGCTAATCCTCAAGGATA
>probe:Drosophila_2:1628962_at:502:651; Interrogation_Position=1464; Antisense; TCAAGGATATTCCTATACCATAGGC
>probe:Drosophila_2:1628962_at:342:9; Interrogation_Position=1478; Antisense; ATACCATAGGCATAAGACATTTTTT

Paste this into a BLAST search page for me
GGCCAGGTCCGGATCCATAGCAGCTAGAAGATGCGCCACATCAGTCCGGAATGCGCCACATCAGTCCGGACAGTGAGTGGGCACAATTCCACCAGCGACTAATTCCACCAGCGACTGCGAGCTGGAGGATGCCTGTCAGCTGGATGCCATTCAGCTGGATGCCATGTGGTTGCAATGCCATGTGGTTGCAAGTGCAGGCCAAGTGCAGGCCAGAGACGCCACGAAAGAGACGCCACGAAGAGACGCCTCATCAGCTTCTCCCTGGTGGAAGAAAGGGAAGAAAGCTAATCCTCAAGGATATCAAGGATATTCCTATACCATAGGCATACCATAGGCATAAGACATTTTTT

Full Affymetrix probeset data:

Annotations for 1628962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720