FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628963_at:

>probe:Drosophila_2:1628963_at:125:29; Interrogation_Position=465; Antisense; ATACGATGGTGCGATCCTTTTGCCA
>probe:Drosophila_2:1628963_at:618:293; Interrogation_Position=476; Antisense; CGATCCTTTTGCCAGTCACTGAAAG
>probe:Drosophila_2:1628963_at:357:313; Interrogation_Position=486; Antisense; GCCAGTCACTGAAAGAATTCGATAT
>probe:Drosophila_2:1628963_at:682:237; Interrogation_Position=521; Antisense; AATCTACAATCTGCATATGACCGGG
>probe:Drosophila_2:1628963_at:42:237; Interrogation_Position=528; Antisense; AATCTGCATATGACCGGGCCGTAAG
>probe:Drosophila_2:1628963_at:111:609; Interrogation_Position=538; Antisense; TGACCGGGCCGTAAGCTTTTGTAAG
>probe:Drosophila_2:1628963_at:454:279; Interrogation_Position=715; Antisense; CTACGCCCAGGGATGCGAGGTCATG
>probe:Drosophila_2:1628963_at:366:49; Interrogation_Position=727; Antisense; ATGCGAGGTCATGGAGGTTAGCTCC
>probe:Drosophila_2:1628963_at:280:547; Interrogation_Position=739; Antisense; GGAGGTTAGCTCCAAAGAGGCCAAC
>probe:Drosophila_2:1628963_at:164:171; Interrogation_Position=752; Antisense; AAAGAGGCCAACGAGGCCACCTATG
>probe:Drosophila_2:1628963_at:119:199; Interrogation_Position=761; Antisense; AACGAGGCCACCTATGCCGAATGAT
>probe:Drosophila_2:1628963_at:531:313; Interrogation_Position=767; Antisense; GCCACCTATGCCGAATGATTTTGAA
>probe:Drosophila_2:1628963_at:17:27; Interrogation_Position=809; Antisense; ATAGCTTATGTTTTCGTAGCCATAT
>probe:Drosophila_2:1628963_at:651:485; Interrogation_Position=824; Antisense; GTAGCCATATTACATTTTTACTATT

Paste this into a BLAST search page for me
ATACGATGGTGCGATCCTTTTGCCACGATCCTTTTGCCAGTCACTGAAAGGCCAGTCACTGAAAGAATTCGATATAATCTACAATCTGCATATGACCGGGAATCTGCATATGACCGGGCCGTAAGTGACCGGGCCGTAAGCTTTTGTAAGCTACGCCCAGGGATGCGAGGTCATGATGCGAGGTCATGGAGGTTAGCTCCGGAGGTTAGCTCCAAAGAGGCCAACAAAGAGGCCAACGAGGCCACCTATGAACGAGGCCACCTATGCCGAATGATGCCACCTATGCCGAATGATTTTGAAATAGCTTATGTTTTCGTAGCCATATGTAGCCATATTACATTTTTACTATT

Full Affymetrix probeset data:

Annotations for 1628963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720