FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628965_at:

>probe:Drosophila_2:1628965_at:10:59; Interrogation_Position=1000; Antisense; ATGATTTGTGACCATTTCCGAAAAC
>probe:Drosophila_2:1628965_at:700:521; Interrogation_Position=499; Antisense; GTGGCCAGCGACCAGCAACATAACC
>probe:Drosophila_2:1628965_at:588:7; Interrogation_Position=560; Antisense; ATTCCAGTCCCTCTATCATTAAAAG
>probe:Drosophila_2:1628965_at:420:431; Interrogation_Position=584; Antisense; GAGTGCTGGACATGCTTAGGCCATC
>probe:Drosophila_2:1628965_at:180:269; Interrogation_Position=594; Antisense; CATGCTTAGGCCATCCATAGGAGTA
>probe:Drosophila_2:1628965_at:354:35; Interrogation_Position=618; Antisense; ATCAGGTCTGCGGAGTCGTTGGACT
>probe:Drosophila_2:1628965_at:621:431; Interrogation_Position=630; Antisense; GAGTCGTTGGACTGAATCCGCAAAA
>probe:Drosophila_2:1628965_at:296:165; Interrogation_Position=652; Antisense; AAATCAGCTGCAACGGGCTTGGCAA
>probe:Drosophila_2:1628965_at:645:257; Interrogation_Position=687; Antisense; CACTCACCCACTTAGTGCTGAGGAG
>probe:Drosophila_2:1628965_at:225:679; Interrogation_Position=699; Antisense; TAGTGCTGAGGAGCTCCTACCGCAG
>probe:Drosophila_2:1628965_at:514:353; Interrogation_Position=732; Antisense; GCAGCGCAGGTTTCTGGACGATGCT
>probe:Drosophila_2:1628965_at:115:557; Interrogation_Position=747; Antisense; GGACGATGCTATTACGCGACTGGAG
>probe:Drosophila_2:1628965_at:440:407; Interrogation_Position=764; Antisense; GACTGGAGCTCTTGGCCGTCAAGAA
>probe:Drosophila_2:1628965_at:147:129; Interrogation_Position=927; Antisense; ACCAGATTCGTTGAGTCACTGTCAA

Paste this into a BLAST search page for me
ATGATTTGTGACCATTTCCGAAAACGTGGCCAGCGACCAGCAACATAACCATTCCAGTCCCTCTATCATTAAAAGGAGTGCTGGACATGCTTAGGCCATCCATGCTTAGGCCATCCATAGGAGTAATCAGGTCTGCGGAGTCGTTGGACTGAGTCGTTGGACTGAATCCGCAAAAAAATCAGCTGCAACGGGCTTGGCAACACTCACCCACTTAGTGCTGAGGAGTAGTGCTGAGGAGCTCCTACCGCAGGCAGCGCAGGTTTCTGGACGATGCTGGACGATGCTATTACGCGACTGGAGGACTGGAGCTCTTGGCCGTCAAGAAACCAGATTCGTTGAGTCACTGTCAA

Full Affymetrix probeset data:

Annotations for 1628965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720