Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628967_at:

>probe:Drosophila_2:1628967_at:589:257; Interrogation_Position=195; Antisense; CACATTTAATAATCACTGCCGCCGC
>probe:Drosophila_2:1628967_at:222:143; Interrogation_Position=236; Antisense; ACTGGCGAAATGTCTCTCGTTGCGA
>probe:Drosophila_2:1628967_at:565:643; Interrogation_Position=250; Antisense; TCTCGTTGCGAATTGTCTCTGGCTA
>probe:Drosophila_2:1628967_at:142:641; Interrogation_Position=265; Antisense; TCTCTGGCTACTTGTCGATTGACAC
>probe:Drosophila_2:1628967_at:430:399; Interrogation_Position=285; Antisense; GACACTCGAGCGTTGTGCTGTTATA
>probe:Drosophila_2:1628967_at:40:711; Interrogation_Position=366; Antisense; TTCAAGGAGGACAACCCGGCGAATT
>probe:Drosophila_2:1628967_at:374:407; Interrogation_Position=401; Antisense; GACGACCTCGAACTACTCGTAGGAC
>probe:Drosophila_2:1628967_at:303:337; Interrogation_Position=442; Antisense; GCTCCAACTACTAGATCTTCTCGTA
>probe:Drosophila_2:1628967_at:611:1; Interrogation_Position=461; Antisense; CTCGTAGAACTACACGTCGTCGTGC
>probe:Drosophila_2:1628967_at:551:289; Interrogation_Position=481; Antisense; CGTGCTCCAACAACTAGAACTACTC
>probe:Drosophila_2:1628967_at:108:505; Interrogation_Position=524; Antisense; GTGCGCCAACTACTAGAACTACGAC
>probe:Drosophila_2:1628967_at:703:135; Interrogation_Position=544; Antisense; ACGACTCGTCGACCTACTGAAGAAT
>probe:Drosophila_2:1628967_at:211:17; Interrogation_Position=67; Antisense; ATTTTTGCTATTCTCTGCCTTTGCG
>probe:Drosophila_2:1628967_at:691:581; Interrogation_Position=92; Antisense; TGGCTGTTCAGGCTCAAACTCGTGA

Paste this into a BLAST search page for me
CACATTTAATAATCACTGCCGCCGCACTGGCGAAATGTCTCTCGTTGCGATCTCGTTGCGAATTGTCTCTGGCTATCTCTGGCTACTTGTCGATTGACACGACACTCGAGCGTTGTGCTGTTATATTCAAGGAGGACAACCCGGCGAATTGACGACCTCGAACTACTCGTAGGACGCTCCAACTACTAGATCTTCTCGTACTCGTAGAACTACACGTCGTCGTGCCGTGCTCCAACAACTAGAACTACTCGTGCGCCAACTACTAGAACTACGACACGACTCGTCGACCTACTGAAGAATATTTTTGCTATTCTCTGCCTTTGCGTGGCTGTTCAGGCTCAAACTCGTGA

Full Affymetrix probeset data:

Annotations for 1628967_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime