FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628968_at:

>probe:Drosophila_2:1628968_at:613:631; Interrogation_Position=114; Antisense; TCCGGAGCCCGGATGATGATGCAAC
>probe:Drosophila_2:1628968_at:341:445; Interrogation_Position=131; Antisense; GATGCAACACCCATGGTTGACGGCA
>probe:Drosophila_2:1628968_at:365:549; Interrogation_Position=159; Antisense; GGAGTTGCCGTCTATGCCACCAGAG
>probe:Drosophila_2:1628968_at:206:49; Interrogation_Position=172; Antisense; ATGCCACCAGAGTCATTTGGGTCAA
>probe:Drosophila_2:1628968_at:704:189; Interrogation_Position=18; Antisense; AACATGAGTGAGTCCGCATCTGAGG
>probe:Drosophila_2:1628968_at:588:19; Interrogation_Position=186; Antisense; ATTTGGGTCAAGTTGCGTGTGCTCC
>probe:Drosophila_2:1628968_at:690:515; Interrogation_Position=202; Antisense; GTGTGCTCCGGTTGGCCAAACAGTT
>probe:Drosophila_2:1628968_at:576:179; Interrogation_Position=219; Antisense; AAACAGTTGCGCCTCCAGAAGCAAA
>probe:Drosophila_2:1628968_at:270:707; Interrogation_Position=248; Antisense; TTGGAAGTCTAATCCCTGGCAGGAC
>probe:Drosophila_2:1628968_at:693:559; Interrogation_Position=269; Antisense; GGACAATGAATCTGGCTCTGAGGCA
>probe:Drosophila_2:1628968_at:104:555; Interrogation_Position=314; Antisense; GGAAGGCGATTCTGACGAGTCTACA
>probe:Drosophila_2:1628968_at:507:605; Interrogation_Position=380; Antisense; TGATCGGTTAGTCCGAGTGCCGCAA
>probe:Drosophila_2:1628968_at:309:507; Interrogation_Position=396; Antisense; GTGCCGCAATAGTTTTTCAAGATGT
>probe:Drosophila_2:1628968_at:64:459; Interrogation_Position=468; Antisense; GATTAGAGGGTACCATATGCTTTAA

Paste this into a BLAST search page for me
TCCGGAGCCCGGATGATGATGCAACGATGCAACACCCATGGTTGACGGCAGGAGTTGCCGTCTATGCCACCAGAGATGCCACCAGAGTCATTTGGGTCAAAACATGAGTGAGTCCGCATCTGAGGATTTGGGTCAAGTTGCGTGTGCTCCGTGTGCTCCGGTTGGCCAAACAGTTAAACAGTTGCGCCTCCAGAAGCAAATTGGAAGTCTAATCCCTGGCAGGACGGACAATGAATCTGGCTCTGAGGCAGGAAGGCGATTCTGACGAGTCTACATGATCGGTTAGTCCGAGTGCCGCAAGTGCCGCAATAGTTTTTCAAGATGTGATTAGAGGGTACCATATGCTTTAA

Full Affymetrix probeset data:

Annotations for 1628968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720