FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628970_at:

>probe:Drosophila_2:1628970_at:628:25; Interrogation_Position=1539; Antisense; ATAGCTTGGCGCGTTCCGTGGTAAC
>probe:Drosophila_2:1628970_at:353:519; Interrogation_Position=1556; Antisense; GTGGTAACTGCCTCCATTGAAGTCC
>probe:Drosophila_2:1628970_at:564:5; Interrogation_Position=1571; Antisense; ATTGAAGTCCATGCGGTGGCCATCG
>probe:Drosophila_2:1628970_at:673:521; Interrogation_Position=1586; Antisense; GTGGCCATCGTCGTGATCGGAGTCA
>probe:Drosophila_2:1628970_at:535:591; Interrogation_Position=1620; Antisense; TGGTGCAAAAGATCTCCCACTTTCG
>probe:Drosophila_2:1628970_at:668:11; Interrogation_Position=1658; Antisense; ATTCTCTTCGTTAGCCACATGCGCT
>probe:Drosophila_2:1628970_at:641:431; Interrogation_Position=1688; Antisense; GAGGATTACGTTTCCATTTACCACA
>probe:Drosophila_2:1628970_at:141:17; Interrogation_Position=1703; Antisense; ATTTACCACAACGTGACCATGCTTC
>probe:Drosophila_2:1628970_at:20:703; Interrogation_Position=1746; Antisense; TTATTGCACATAGGCGGAACGTCTT
>probe:Drosophila_2:1628970_at:514:559; Interrogation_Position=1761; Antisense; GGAACGTCTTCCTTAAGGCCATATA
>probe:Drosophila_2:1628970_at:515:27; Interrogation_Position=1783; Antisense; ATACGCGTTGGCCTATTTGGTGAAG
>probe:Drosophila_2:1628970_at:413:155; Interrogation_Position=1902; Antisense; ACAGAACTAACTTTGCGTCGCACAT
>probe:Drosophila_2:1628970_at:69:561; Interrogation_Position=1930; Antisense; GGAAATCCTGTTCCCTGTGGACCAG
>probe:Drosophila_2:1628970_at:514:367; Interrogation_Position=2039; Antisense; GAATGTTAACGCGTTGGCCTAGAAT

Paste this into a BLAST search page for me
ATAGCTTGGCGCGTTCCGTGGTAACGTGGTAACTGCCTCCATTGAAGTCCATTGAAGTCCATGCGGTGGCCATCGGTGGCCATCGTCGTGATCGGAGTCATGGTGCAAAAGATCTCCCACTTTCGATTCTCTTCGTTAGCCACATGCGCTGAGGATTACGTTTCCATTTACCACAATTTACCACAACGTGACCATGCTTCTTATTGCACATAGGCGGAACGTCTTGGAACGTCTTCCTTAAGGCCATATAATACGCGTTGGCCTATTTGGTGAAGACAGAACTAACTTTGCGTCGCACATGGAAATCCTGTTCCCTGTGGACCAGGAATGTTAACGCGTTGGCCTAGAAT

Full Affymetrix probeset data:

Annotations for 1628970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720