FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628972_at:

>probe:Drosophila_2:1628972_at:336:515; Interrogation_Position=253; Antisense; GTGGGCAACTATTCGGTAGCCGCTC
>probe:Drosophila_2:1628972_at:705:301; Interrogation_Position=283; Antisense; CCGACGATGGGCTGGGATTTTGAAC
>probe:Drosophila_2:1628972_at:507:215; Interrogation_Position=355; Antisense; AAGTTTTGCGCCAATACCGACAAGT
>probe:Drosophila_2:1628972_at:416:61; Interrogation_Position=386; Antisense; ATGTGGCAACCACCGAAATCCGTAG
>probe:Drosophila_2:1628972_at:456:283; Interrogation_Position=460; Antisense; CTGCCGGAGTTGTTTCTGGATGTCA
>probe:Drosophila_2:1628972_at:299:371; Interrogation_Position=526; Antisense; GAAGGAACCTGTGTGGGCCACTATA
>probe:Drosophila_2:1628972_at:449:65; Interrogation_Position=569; Antisense; ATGGTTCTCGTATGGGATGCGGCCT
>probe:Drosophila_2:1628972_at:610:89; Interrogation_Position=620; Antisense; AGTCAAATATTATCCTGCTCTGCCA
>probe:Drosophila_2:1628972_at:624:695; Interrogation_Position=647; Antisense; TTTCGCGGGCCAGTGTGAACAACCT
>probe:Drosophila_2:1628972_at:14:387; Interrogation_Position=663; Antisense; GAACAACCTGGTTCCGTACGAAGAG
>probe:Drosophila_2:1628972_at:26:215; Interrogation_Position=683; Antisense; AAGAGGGCCAGATTCCTGCCGGGAA
>probe:Drosophila_2:1628972_at:594:99; Interrogation_Position=728; Antisense; AGATGTACCAGTTCCTCTGCAGCGA
>probe:Drosophila_2:1628972_at:225:57; Interrogation_Position=755; Antisense; ATGAGTACGTCGATGCCAACAGCAT
>probe:Drosophila_2:1628972_at:415:563; Interrogation_Position=786; Antisense; GGAATCGAATATGCCGTCCAGCGAC

Paste this into a BLAST search page for me
GTGGGCAACTATTCGGTAGCCGCTCCCGACGATGGGCTGGGATTTTGAACAAGTTTTGCGCCAATACCGACAAGTATGTGGCAACCACCGAAATCCGTAGCTGCCGGAGTTGTTTCTGGATGTCAGAAGGAACCTGTGTGGGCCACTATAATGGTTCTCGTATGGGATGCGGCCTAGTCAAATATTATCCTGCTCTGCCATTTCGCGGGCCAGTGTGAACAACCTGAACAACCTGGTTCCGTACGAAGAGAAGAGGGCCAGATTCCTGCCGGGAAAGATGTACCAGTTCCTCTGCAGCGAATGAGTACGTCGATGCCAACAGCATGGAATCGAATATGCCGTCCAGCGAC

Full Affymetrix probeset data:

Annotations for 1628972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720