FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628976_at:

>probe:Drosophila_2:1628976_at:258:171; Interrogation_Position=1020; Antisense; AAAGATTGTTCCACAGTTCTGAAGA
>probe:Drosophila_2:1628976_at:454:713; Interrogation_Position=1036; Antisense; TTCTGAAGATCACAATGCGCGAGCT
>probe:Drosophila_2:1628976_at:703:43; Interrogation_Position=1140; Antisense; ATCGCCATGTGCTTTATCGACCGAT
>probe:Drosophila_2:1628976_at:243:677; Interrogation_Position=1154; Antisense; TATCGACCGATTCCCATTTACTAAT
>probe:Drosophila_2:1628976_at:204:21; Interrogation_Position=652; Antisense; ATATCAACCCAGTAGCGCCCGAAAA
>probe:Drosophila_2:1628976_at:689:703; Interrogation_Position=682; Antisense; TTATGTCTAACTAATCCCGATCCAC
>probe:Drosophila_2:1628976_at:555:649; Interrogation_Position=693; Antisense; TAATCCCGATCCACCATTTGAAATG
>probe:Drosophila_2:1628976_at:329:147; Interrogation_Position=732; Antisense; ACTTCGCAGCCCATTGAATTCTAGT
>probe:Drosophila_2:1628976_at:241:241; Interrogation_Position=772; Antisense; AATAACCCATAATCCCGTGATCTGC
>probe:Drosophila_2:1628976_at:544:625; Interrogation_Position=794; Antisense; TGCCCGGTGATAACATGCGATTCGA
>probe:Drosophila_2:1628976_at:32:463; Interrogation_Position=812; Antisense; GATTCGATTATGACCGGATTCCCAT
>probe:Drosophila_2:1628976_at:141:289; Interrogation_Position=858; Antisense; CGGCGCCAGTATTTGCGTGCATTAT
>probe:Drosophila_2:1628976_at:571:717; Interrogation_Position=870; Antisense; TTGCGTGCATTATTTCCCAACCGAA
>probe:Drosophila_2:1628976_at:546:1; Interrogation_Position=907; Antisense; ATTAAGTTACATGACCGCTCCGTTA

Paste this into a BLAST search page for me
AAAGATTGTTCCACAGTTCTGAAGATTCTGAAGATCACAATGCGCGAGCTATCGCCATGTGCTTTATCGACCGATTATCGACCGATTCCCATTTACTAATATATCAACCCAGTAGCGCCCGAAAATTATGTCTAACTAATCCCGATCCACTAATCCCGATCCACCATTTGAAATGACTTCGCAGCCCATTGAATTCTAGTAATAACCCATAATCCCGTGATCTGCTGCCCGGTGATAACATGCGATTCGAGATTCGATTATGACCGGATTCCCATCGGCGCCAGTATTTGCGTGCATTATTTGCGTGCATTATTTCCCAACCGAAATTAAGTTACATGACCGCTCCGTTA

Full Affymetrix probeset data:

Annotations for 1628976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720