FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628977_at:

>probe:Drosophila_2:1628977_at:506:453; Interrogation_Position=1502; Antisense; GATATAGAGAGGTCCGCACACGCAC
>probe:Drosophila_2:1628977_at:695:259; Interrogation_Position=1528; Antisense; CAGCCCGAATCCGATTTTCCTTTTG
>probe:Drosophila_2:1628977_at:402:655; Interrogation_Position=1548; Antisense; TTTTGGTTTACACCCGAGATAGCCT
>probe:Drosophila_2:1628977_at:526:457; Interrogation_Position=1565; Antisense; GATAGCCTCACAGCCAGCAAACAAT
>probe:Drosophila_2:1628977_at:66:27; Interrogation_Position=1588; Antisense; ATAGACGAATACTCGAACTCGCAAA
>probe:Drosophila_2:1628977_at:49:365; Interrogation_Position=1617; Antisense; GAATTTTGTACTTAGCAGAGCTTAA
>probe:Drosophila_2:1628977_at:498:101; Interrogation_Position=1633; Antisense; AGAGCTTAAACGCTCTTCCACCATA
>probe:Drosophila_2:1628977_at:377:199; Interrogation_Position=1641; Antisense; AACGCTCTTCCACCATAGCAATAAT
>probe:Drosophila_2:1628977_at:32:429; Interrogation_Position=1768; Antisense; GAGATAGATTATTTAGCCACACATG
>probe:Drosophila_2:1628977_at:676:281; Interrogation_Position=1811; Antisense; CTCGAAACTGCCGACTGTAGTCAAG
>probe:Drosophila_2:1628977_at:28:457; Interrogation_Position=1827; Antisense; GTAGTCAAGAAACAACTTCCAATAG
>probe:Drosophila_2:1628977_at:644:481; Interrogation_Position=1904; Antisense; GTATTCCAAATGCTTGGCCAGTTGA
>probe:Drosophila_2:1628977_at:671:175; Interrogation_Position=1973; Antisense; AAACGCAATTAAAGCCGCACTCACA
>probe:Drosophila_2:1628977_at:193:355; Interrogation_Position=1989; Antisense; GCACTCACACGACAACACGGATAGT

Paste this into a BLAST search page for me
GATATAGAGAGGTCCGCACACGCACCAGCCCGAATCCGATTTTCCTTTTGTTTTGGTTTACACCCGAGATAGCCTGATAGCCTCACAGCCAGCAAACAATATAGACGAATACTCGAACTCGCAAAGAATTTTGTACTTAGCAGAGCTTAAAGAGCTTAAACGCTCTTCCACCATAAACGCTCTTCCACCATAGCAATAATGAGATAGATTATTTAGCCACACATGCTCGAAACTGCCGACTGTAGTCAAGGTAGTCAAGAAACAACTTCCAATAGGTATTCCAAATGCTTGGCCAGTTGAAAACGCAATTAAAGCCGCACTCACAGCACTCACACGACAACACGGATAGT

Full Affymetrix probeset data:

Annotations for 1628977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720