FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628978_at:

>probe:Drosophila_2:1628978_at:527:679; Interrogation_Position=3279; Antisense; TATGATGCCCATAAATCCTCTCCGA
>probe:Drosophila_2:1628978_at:226:279; Interrogation_Position=3296; Antisense; CTCTCCGATCCCTTGAAATTCTAGG
>probe:Drosophila_2:1628978_at:323:225; Interrogation_Position=3330; Antisense; AAGGAGCTGCCCGACGTGTAAATGA
>probe:Drosophila_2:1628978_at:468:429; Interrogation_Position=3353; Antisense; GAGTTTTAGCTCTTTAGCCTTGTAA
>probe:Drosophila_2:1628978_at:544:699; Interrogation_Position=3432; Antisense; TTTATTAATTCAACTGTCAGGTCTC
>probe:Drosophila_2:1628978_at:589:599; Interrogation_Position=3446; Antisense; TGTCAGGTCTCTTTAAACCCTTTCA
>probe:Drosophila_2:1628978_at:71:453; Interrogation_Position=3535; Antisense; GATCTTATAGATCGCCTCTTCTTCG
>probe:Drosophila_2:1628978_at:715:211; Interrogation_Position=3566; Antisense; AAGACTCCCGACTTTTCCTTGAGCT
>probe:Drosophila_2:1628978_at:702:491; Interrogation_Position=3626; Antisense; GTAACGGCATACATACATGATCTAT
>probe:Drosophila_2:1628978_at:366:65; Interrogation_Position=3651; Antisense; ATGGGATTTATTTTATGCGACTCAA
>probe:Drosophila_2:1628978_at:72:369; Interrogation_Position=3683; Antisense; GAATGCAATATTTTCCACTGAAGTT
>probe:Drosophila_2:1628978_at:271:147; Interrogation_Position=3751; Antisense; ACTTAACTACCGCACGAGTACTCAA
>probe:Drosophila_2:1628978_at:152:355; Interrogation_Position=3762; Antisense; GCACGAGTACTCAATGCAACTGAAA
>probe:Drosophila_2:1628978_at:575:89; Interrogation_Position=3827; Antisense; AGTATAATAAAAGCGCCCCAATCAA

Paste this into a BLAST search page for me
TATGATGCCCATAAATCCTCTCCGACTCTCCGATCCCTTGAAATTCTAGGAAGGAGCTGCCCGACGTGTAAATGAGAGTTTTAGCTCTTTAGCCTTGTAATTTATTAATTCAACTGTCAGGTCTCTGTCAGGTCTCTTTAAACCCTTTCAGATCTTATAGATCGCCTCTTCTTCGAAGACTCCCGACTTTTCCTTGAGCTGTAACGGCATACATACATGATCTATATGGGATTTATTTTATGCGACTCAAGAATGCAATATTTTCCACTGAAGTTACTTAACTACCGCACGAGTACTCAAGCACGAGTACTCAATGCAACTGAAAAGTATAATAAAAGCGCCCCAATCAA

Full Affymetrix probeset data:

Annotations for 1628978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720