Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628979_at:

>probe:Drosophila_2:1628979_at:297:195; Interrogation_Position=1069; Antisense; AACTGCTGACCGCTGCTGGAATTTT
>probe:Drosophila_2:1628979_at:424:631; Interrogation_Position=1093; Antisense; TCCGAGGAAGAATGTCACCGCGTGA
>probe:Drosophila_2:1628979_at:590:243; Interrogation_Position=1161; Antisense; AATTTCGTGGACTGGATACCCAACA
>probe:Drosophila_2:1628979_at:161:571; Interrogation_Position=1196; Antisense; GGCTATTTGCGATATACCGCCGAGG
>probe:Drosophila_2:1628979_at:161:13; Interrogation_Position=1241; Antisense; ATTCATTGGCAACACAACGGCGATT
>probe:Drosophila_2:1628979_at:342:191; Interrogation_Position=1256; Antisense; AACGGCGATTCAGACGCTGTTCCAG
>probe:Drosophila_2:1628979_at:260:121; Interrogation_Position=1279; Antisense; AGCGATTACTGGACGCTTCCATGTC
>probe:Drosophila_2:1628979_at:602:719; Interrogation_Position=1295; Antisense; TTCCATGTCCATGTTGCGGCGCAAG
>probe:Drosophila_2:1628979_at:37:309; Interrogation_Position=1322; Antisense; CCATCTTCACTGGTACACGGGAGAG
>probe:Drosophila_2:1628979_at:729:187; Interrogation_Position=1357; Antisense; AACAGGAGTTCCAGGATGCGCAGCA
>probe:Drosophila_2:1628979_at:487:349; Interrogation_Position=1379; Antisense; GCAGGAGTTACAAGCCATCATCGAT
>probe:Drosophila_2:1628979_at:303:271; Interrogation_Position=1397; Antisense; CATCGATGATTACCGCAGTAGTGCT
>probe:Drosophila_2:1628979_at:68:135; Interrogation_Position=1500; Antisense; ACGCCCGAAGCCCATTGTCAATATT
>probe:Drosophila_2:1628979_at:721:491; Interrogation_Position=1602; Antisense; GTAATTACGCGTCTTGGAATCAGGA

Paste this into a BLAST search page for me
AACTGCTGACCGCTGCTGGAATTTTTCCGAGGAAGAATGTCACCGCGTGAAATTTCGTGGACTGGATACCCAACAGGCTATTTGCGATATACCGCCGAGGATTCATTGGCAACACAACGGCGATTAACGGCGATTCAGACGCTGTTCCAGAGCGATTACTGGACGCTTCCATGTCTTCCATGTCCATGTTGCGGCGCAAGCCATCTTCACTGGTACACGGGAGAGAACAGGAGTTCCAGGATGCGCAGCAGCAGGAGTTACAAGCCATCATCGATCATCGATGATTACCGCAGTAGTGCTACGCCCGAAGCCCATTGTCAATATTGTAATTACGCGTCTTGGAATCAGGA

Full Affymetrix probeset data:

Annotations for 1628979_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime