FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628982_at:

>probe:Drosophila_2:1628982_at:480:119; Interrogation_Position=2553; Antisense; AGCTGCAATCGATTATGACCCGTCT
>probe:Drosophila_2:1628982_at:690:3; Interrogation_Position=2612; Antisense; ATTGGCAATCAATCCTGGAGCAGCA
>probe:Drosophila_2:1628982_at:335:115; Interrogation_Position=2633; Antisense; AGCAGGCGGCTGGAGCAGCATTCTA
>probe:Drosophila_2:1628982_at:229:115; Interrogation_Position=2649; Antisense; AGCATTCTAGGGAGGCGACTGCCTG
>probe:Drosophila_2:1628982_at:453:405; Interrogation_Position=2665; Antisense; GACTGCCTGTCACCCATAGACTTAA
>probe:Drosophila_2:1628982_at:504:727; Interrogation_Position=2696; Antisense; TTGTCCAGTGATCCAAAGCCAAGCT
>probe:Drosophila_2:1628982_at:6:127; Interrogation_Position=2712; Antisense; AGCCAAGCTGAGTTAGCCCTAAGTT
>probe:Drosophila_2:1628982_at:127:107; Interrogation_Position=2738; Antisense; AGACACACGCGACTAAGAGCTCGAA
>probe:Drosophila_2:1628982_at:254:419; Interrogation_Position=2754; Antisense; GAGCTCGAAGCCTGTAAACTATTCT
>probe:Drosophila_2:1628982_at:139:127; Interrogation_Position=2785; Antisense; ACCATGTCATGGCATCCATCATCAA
>probe:Drosophila_2:1628982_at:123:659; Interrogation_Position=2923; Antisense; TAAGTTCTCTCAACAGTTCCTAGGA
>probe:Drosophila_2:1628982_at:124:39; Interrogation_Position=2962; Antisense; ATCTCAGCATTTCTTGGTATCATCT
>probe:Drosophila_2:1628982_at:279:33; Interrogation_Position=3003; Antisense; ATAATTGATGTTCTGTTCGCTATTC
>probe:Drosophila_2:1628982_at:300:457; Interrogation_Position=3039; Antisense; GATAGGTCGAAGTCCACTAAGCCAA

Paste this into a BLAST search page for me
AGCTGCAATCGATTATGACCCGTCTATTGGCAATCAATCCTGGAGCAGCAAGCAGGCGGCTGGAGCAGCATTCTAAGCATTCTAGGGAGGCGACTGCCTGGACTGCCTGTCACCCATAGACTTAATTGTCCAGTGATCCAAAGCCAAGCTAGCCAAGCTGAGTTAGCCCTAAGTTAGACACACGCGACTAAGAGCTCGAAGAGCTCGAAGCCTGTAAACTATTCTACCATGTCATGGCATCCATCATCAATAAGTTCTCTCAACAGTTCCTAGGAATCTCAGCATTTCTTGGTATCATCTATAATTGATGTTCTGTTCGCTATTCGATAGGTCGAAGTCCACTAAGCCAA

Full Affymetrix probeset data:

Annotations for 1628982_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720