Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628984_s_at:

>probe:Drosophila_2:1628984_s_at:495:275; Interrogation_Position=1002; Antisense; CTTTAGCAACTTTCGATCGCGTCAA
>probe:Drosophila_2:1628984_s_at:276:275; Interrogation_Position=1011; Antisense; CTTTCGATCGCGTCAAGTTATTTGA
>probe:Drosophila_2:1628984_s_at:140:477; Interrogation_Position=1027; Antisense; GTTATTTGAATTTTGAGTCCCTCGA
>probe:Drosophila_2:1628984_s_at:501:245; Interrogation_Position=1035; Antisense; AATTTTGAGTCCCTCGATTCGAGAG
>probe:Drosophila_2:1628984_s_at:473:413; Interrogation_Position=565; Antisense; GAGCGAGTAGACACGGTTGCATCCA
>probe:Drosophila_2:1628984_s_at:214:141; Interrogation_Position=577; Antisense; ACGGTTGCATCCATCGCAATGGGCA
>probe:Drosophila_2:1628984_s_at:401:361; Interrogation_Position=592; Antisense; GCAATGGGCAACGTTTTTCTGCATA
>probe:Drosophila_2:1628984_s_at:401:557; Interrogation_Position=598; Antisense; GGCAACGTTTTTCTGCATAAGTTTT
>probe:Drosophila_2:1628984_s_at:23:159; Interrogation_Position=811; Antisense; ACACACATGCCAACACACAGCATAA
>probe:Drosophila_2:1628984_s_at:387:453; Interrogation_Position=865; Antisense; GATCACACAAACATTATTTCCAGTC
>probe:Drosophila_2:1628984_s_at:693:627; Interrogation_Position=883; Antisense; TCCAGTCATCTGTTCTTTATATTCT
>probe:Drosophila_2:1628984_s_at:669:469; Interrogation_Position=894; Antisense; GTTCTTTATATTCTAGGTTTGTACG
>probe:Drosophila_2:1628984_s_at:637:191; Interrogation_Position=928; Antisense; AACTATATGTATGACACTACTCCCA
>probe:Drosophila_2:1628984_s_at:5:613; Interrogation_Position=939; Antisense; TGACACTACTCCCAAAAACACATAC

Paste this into a BLAST search page for me
CTTTAGCAACTTTCGATCGCGTCAACTTTCGATCGCGTCAAGTTATTTGAGTTATTTGAATTTTGAGTCCCTCGAAATTTTGAGTCCCTCGATTCGAGAGGAGCGAGTAGACACGGTTGCATCCAACGGTTGCATCCATCGCAATGGGCAGCAATGGGCAACGTTTTTCTGCATAGGCAACGTTTTTCTGCATAAGTTTTACACACATGCCAACACACAGCATAAGATCACACAAACATTATTTCCAGTCTCCAGTCATCTGTTCTTTATATTCTGTTCTTTATATTCTAGGTTTGTACGAACTATATGTATGACACTACTCCCATGACACTACTCCCAAAAACACATAC

Full Affymetrix probeset data:

Annotations for 1628984_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime