FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628987_at:

>probe:Drosophila_2:1628987_at:682:343; Interrogation_Position=430; Antisense; GCATTTCGTACCCAATGTGCTTCAT
>probe:Drosophila_2:1628987_at:255:159; Interrogation_Position=460; Antisense; ACACACCCAGGGATAGCCAGATCGA
>probe:Drosophila_2:1628987_at:1:445; Interrogation_Position=491; Antisense; GATGATGTACGCCTGCACGAAGAGC
>probe:Drosophila_2:1628987_at:651:373; Interrogation_Position=509; Antisense; GAAGAGCGCTCTTCAGCGCGAAGTA
>probe:Drosophila_2:1628987_at:332:325; Interrogation_Position=526; Antisense; GCGAAGTAGATCTCACACGCGTCTA
>probe:Drosophila_2:1628987_at:333:329; Interrogation_Position=544; Antisense; GCGTCTACGAGATACGCGAACTAGA
>probe:Drosophila_2:1628987_at:44:297; Interrogation_Position=560; Antisense; CGAACTAGACGAACTCACCGAGGAG
>probe:Drosophila_2:1628987_at:83:427; Interrogation_Position=608; Antisense; GAGAGGTTTCGATCTCTGGGATCAA
>probe:Drosophila_2:1628987_at:269:637; Interrogation_Position=622; Antisense; TCTGGGATCAATCAATCCGGGCCGT
>probe:Drosophila_2:1628987_at:576:233; Interrogation_Position=635; Antisense; AATCCGGGCCGTTGTCAAAAGCAAT
>probe:Drosophila_2:1628987_at:649:317; Interrogation_Position=722; Antisense; GCCGATACCAACGATGCATACCAAT
>probe:Drosophila_2:1628987_at:702:427; Interrogation_Position=765; Antisense; GAGATACTACAATTTTTACCTACAG
>probe:Drosophila_2:1628987_at:97:55; Interrogation_Position=821; Antisense; ATGACATTTTTATATCGACGACAAG
>probe:Drosophila_2:1628987_at:221:379; Interrogation_Position=914; Antisense; GAAGCTGTGCTTGCCAAATTTCTAC

Paste this into a BLAST search page for me
GCATTTCGTACCCAATGTGCTTCATACACACCCAGGGATAGCCAGATCGAGATGATGTACGCCTGCACGAAGAGCGAAGAGCGCTCTTCAGCGCGAAGTAGCGAAGTAGATCTCACACGCGTCTAGCGTCTACGAGATACGCGAACTAGACGAACTAGACGAACTCACCGAGGAGGAGAGGTTTCGATCTCTGGGATCAATCTGGGATCAATCAATCCGGGCCGTAATCCGGGCCGTTGTCAAAAGCAATGCCGATACCAACGATGCATACCAATGAGATACTACAATTTTTACCTACAGATGACATTTTTATATCGACGACAAGGAAGCTGTGCTTGCCAAATTTCTAC

Full Affymetrix probeset data:

Annotations for 1628987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720