Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628991_at:

>probe:Drosophila_2:1628991_at:194:403; Interrogation_Position=1022; Antisense; GACTTCGCAGCGTTTTCAAGGGCAG
>probe:Drosophila_2:1628991_at:252:623; Interrogation_Position=1048; Antisense; TGCGCCACAATGCTCAGGGATTTGC
>probe:Drosophila_2:1628991_at:536:195; Interrogation_Position=1078; Antisense; AACGGGCTGTACTTCCTGGTCTACG
>probe:Drosophila_2:1628991_at:297:33; Interrogation_Position=1147; Antisense; ATCAGTACTGCCTCAACGATTTTCG
>probe:Drosophila_2:1628991_at:230:349; Interrogation_Position=1187; Antisense; GCATGGCCTACTGGATTCTGGGCAT
>probe:Drosophila_2:1628991_at:658:567; Interrogation_Position=1207; Antisense; GGCATGCCAGCCGACGTGTTAAAGA
>probe:Drosophila_2:1628991_at:564:405; Interrogation_Position=1219; Antisense; GACGTGTTAAAGAGCCGCCTACAAT
>probe:Drosophila_2:1628991_at:312:371; Interrogation_Position=1252; Antisense; GAAGGCACCTACAAGCACGGCATAC
>probe:Drosophila_2:1628991_at:511:141; Interrogation_Position=1268; Antisense; ACGGCATACGCAGTGTCTTCAAGGA
>probe:Drosophila_2:1628991_at:153:223; Interrogation_Position=1303; Antisense; AAGGATGGACCTCTGGCCTTGTACC
>probe:Drosophila_2:1628991_at:435:343; Interrogation_Position=1376; Antisense; GCTTCTTCGGCATTGAGTTGGCTAA
>probe:Drosophila_2:1628991_at:589:243; Interrogation_Position=1403; Antisense; AATTCTTTAACATCGTAGCTCCAAA
>probe:Drosophila_2:1628991_at:344:417; Interrogation_Position=922; Antisense; GAGCGCATCAAGGTGCTCCTGCAGA
>probe:Drosophila_2:1628991_at:58:327; Interrogation_Position=965; Antisense; GCGAGCGCAAGTACAACGGCATGAT

Paste this into a BLAST search page for me
GACTTCGCAGCGTTTTCAAGGGCAGTGCGCCACAATGCTCAGGGATTTGCAACGGGCTGTACTTCCTGGTCTACGATCAGTACTGCCTCAACGATTTTCGGCATGGCCTACTGGATTCTGGGCATGGCATGCCAGCCGACGTGTTAAAGAGACGTGTTAAAGAGCCGCCTACAATGAAGGCACCTACAAGCACGGCATACACGGCATACGCAGTGTCTTCAAGGAAAGGATGGACCTCTGGCCTTGTACCGCTTCTTCGGCATTGAGTTGGCTAAAATTCTTTAACATCGTAGCTCCAAAGAGCGCATCAAGGTGCTCCTGCAGAGCGAGCGCAAGTACAACGGCATGAT

Full Affymetrix probeset data:

Annotations for 1628991_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime