Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628992_at:

>probe:Drosophila_2:1628992_at:581:395; Interrogation_Position=15; Antisense; GAAATCAGAGGCGTTGCACAAGTTT
>probe:Drosophila_2:1628992_at:468:237; Interrogation_Position=17; Antisense; AATCAGAGGCGTTGCACAAGTTTCT
>probe:Drosophila_2:1628992_at:625:265; Interrogation_Position=20; Antisense; CAGAGGCGTTGCACAAGTTTCTGGC
>probe:Drosophila_2:1628992_at:586:217; Interrogation_Position=34; Antisense; AAGTTTCTGGCGTTGTATCCGCTGC
>probe:Drosophila_2:1628992_at:538:91; Interrogation_Position=35; Antisense; AGTTTCTGGCGTTGTATCCGCTGCT
>probe:Drosophila_2:1628992_at:394:697; Interrogation_Position=37; Antisense; TTTCTGGCGTTGTATCCGCTGCTGA
>probe:Drosophila_2:1628992_at:514:287; Interrogation_Position=40; Antisense; CTGGCGTTGTATCCGCTGCTGATTG
>probe:Drosophila_2:1628992_at:37:329; Interrogation_Position=43; Antisense; GCGTTGTATCCGCTGCTGATTGCCT
>probe:Drosophila_2:1628992_at:418:467; Interrogation_Position=45; Antisense; GTTGTATCCGCTGCTGATTGCCTGC
>probe:Drosophila_2:1628992_at:451:601; Interrogation_Position=47; Antisense; TGTATCCGCTGCTGATTGCCTGCGC
>probe:Drosophila_2:1628992_at:234:685; Interrogation_Position=49; Antisense; TATCCGCTGCTGATTGCCTGCGCGT
>probe:Drosophila_2:1628992_at:243:303; Interrogation_Position=52; Antisense; CCGCTGCTGATTGCCTGCGCGTGGA
>probe:Drosophila_2:1628992_at:501:321; Interrogation_Position=68; Antisense; GCGCGTGGAGCGCACCATTGAATCC
>probe:Drosophila_2:1628992_at:56:331; Interrogation_Position=70; Antisense; GCGTGGAGCGCACCATTGAATCCAT

Paste this into a BLAST search page for me
GAAATCAGAGGCGTTGCACAAGTTTAATCAGAGGCGTTGCACAAGTTTCTCAGAGGCGTTGCACAAGTTTCTGGCAAGTTTCTGGCGTTGTATCCGCTGCAGTTTCTGGCGTTGTATCCGCTGCTTTTCTGGCGTTGTATCCGCTGCTGACTGGCGTTGTATCCGCTGCTGATTGGCGTTGTATCCGCTGCTGATTGCCTGTTGTATCCGCTGCTGATTGCCTGCTGTATCCGCTGCTGATTGCCTGCGCTATCCGCTGCTGATTGCCTGCGCGTCCGCTGCTGATTGCCTGCGCGTGGAGCGCGTGGAGCGCACCATTGAATCCGCGTGGAGCGCACCATTGAATCCAT

Full Affymetrix probeset data:

Annotations for 1628992_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime