FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628993_at:

>probe:Drosophila_2:1628993_at:3:561; Interrogation_Position=1001; Antisense; GGAACACTCGCGATACGAACCAGGA
>probe:Drosophila_2:1628993_at:470:129; Interrogation_Position=1019; Antisense; ACCAGGAGATGTTTTGCGTGCAAAT
>probe:Drosophila_2:1628993_at:3:419; Interrogation_Position=1069; Antisense; GAGCTGATCTTCGTTTCACCATCAA
>probe:Drosophila_2:1628993_at:204:689; Interrogation_Position=1097; Antisense; TATTCCCGTAAGTATTCCTTTCACG
>probe:Drosophila_2:1628993_at:23:275; Interrogation_Position=1136; Antisense; CATTCGAACGGTTGACAGCCTGATT
>probe:Drosophila_2:1628993_at:368:67; Interrogation_Position=1192; Antisense; AGGCGACTCACTTTGTGGCTGGGCT
>probe:Drosophila_2:1628993_at:378:437; Interrogation_Position=1327; Antisense; GAGGACTCATCCTGCGTTGTACGGC
>probe:Drosophila_2:1628993_at:701:247; Interrogation_Position=1355; Antisense; AATTGGCGATCTCTATCAGGAGTAC
>probe:Drosophila_2:1628993_at:534:183; Interrogation_Position=1405; Antisense; AAAAGGATCCGGTGCCGGCCAGAGT
>probe:Drosophila_2:1628993_at:423:603; Interrogation_Position=1429; Antisense; TGACGCTGTCATCAGGAACCGGACT
>probe:Drosophila_2:1628993_at:682:405; Interrogation_Position=1450; Antisense; GACTGCGTGGCTTCTTGGAGACCTA
>probe:Drosophila_2:1628993_at:699:587; Interrogation_Position=1465; Antisense; TGGAGACCTATTTCGCTACATCTTC
>probe:Drosophila_2:1628993_at:23:325; Interrogation_Position=1545; Antisense; GCGTTGGCCCAACTAATTACTGGTA
>probe:Drosophila_2:1628993_at:381:377; Interrogation_Position=980; Antisense; GAAGCGACCGCAGCTTTTTACGGAA

Paste this into a BLAST search page for me
GGAACACTCGCGATACGAACCAGGAACCAGGAGATGTTTTGCGTGCAAATGAGCTGATCTTCGTTTCACCATCAATATTCCCGTAAGTATTCCTTTCACGCATTCGAACGGTTGACAGCCTGATTAGGCGACTCACTTTGTGGCTGGGCTGAGGACTCATCCTGCGTTGTACGGCAATTGGCGATCTCTATCAGGAGTACAAAAGGATCCGGTGCCGGCCAGAGTTGACGCTGTCATCAGGAACCGGACTGACTGCGTGGCTTCTTGGAGACCTATGGAGACCTATTTCGCTACATCTTCGCGTTGGCCCAACTAATTACTGGTAGAAGCGACCGCAGCTTTTTACGGAA

Full Affymetrix probeset data:

Annotations for 1628993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720