FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628995_at:

>probe:Drosophila_2:1628995_at:302:609; Interrogation_Position=1166; Antisense; TGAGATTTTTCCAAACCTGCTTCCA
>probe:Drosophila_2:1628995_at:45:699; Interrogation_Position=1209; Antisense; TTTTTGGGAACTACAGGCTCTGGAT
>probe:Drosophila_2:1628995_at:185:441; Interrogation_Position=1278; Antisense; GATGGCATGTCTACAGAACACCTGG
>probe:Drosophila_2:1628995_at:1:387; Interrogation_Position=1293; Antisense; GAACACCTGGCTTACTTATCGCAGA
>probe:Drosophila_2:1628995_at:334:705; Interrogation_Position=1308; Antisense; TTATCGCAGAAGCATCTTGGCCCAG
>probe:Drosophila_2:1628995_at:273:581; Interrogation_Position=1325; Antisense; TGGCCCAGAAGCTATCGTACGACGA
>probe:Drosophila_2:1628995_at:621:97; Interrogation_Position=1364; Antisense; AGATGCGCCACCAGATTGAGCTGCA
>probe:Drosophila_2:1628995_at:525:369; Interrogation_Position=1409; Antisense; GAATGGTCCACCTGGCCAAGATCAT
>probe:Drosophila_2:1628995_at:616:75; Interrogation_Position=1444; Antisense; AGGAGCAACTGTCACGGGATCGTCA
>probe:Drosophila_2:1628995_at:40:451; Interrogation_Position=1461; Antisense; GATCGTCACGCATAAAGTCCTTAGC
>probe:Drosophila_2:1628995_at:109:53; Interrogation_Position=1489; Antisense; ATGCTCGATCGCCTGGAGGATGAAC
>probe:Drosophila_2:1628995_at:645:89; Interrogation_Position=1571; Antisense; AGTAAAGCATCCTGCGAATCCGCAA
>probe:Drosophila_2:1628995_at:50:191; Interrogation_Position=1594; Antisense; AACTTTTCTCGCACCAGATTTTTGA
>probe:Drosophila_2:1628995_at:327:723; Interrogation_Position=1626; Antisense; TTGCACCTTTGTGTAAGCCCGTTTA

Paste this into a BLAST search page for me
TGAGATTTTTCCAAACCTGCTTCCATTTTTGGGAACTACAGGCTCTGGATGATGGCATGTCTACAGAACACCTGGGAACACCTGGCTTACTTATCGCAGATTATCGCAGAAGCATCTTGGCCCAGTGGCCCAGAAGCTATCGTACGACGAAGATGCGCCACCAGATTGAGCTGCAGAATGGTCCACCTGGCCAAGATCATAGGAGCAACTGTCACGGGATCGTCAGATCGTCACGCATAAAGTCCTTAGCATGCTCGATCGCCTGGAGGATGAACAGTAAAGCATCCTGCGAATCCGCAAAACTTTTCTCGCACCAGATTTTTGATTGCACCTTTGTGTAAGCCCGTTTA

Full Affymetrix probeset data:

Annotations for 1628995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720