FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628997_at:

>probe:Drosophila_2:1628997_at:189:545; Interrogation_Position=173; Antisense; GGATCGCTGACCAAGTCCCATATGG
>probe:Drosophila_2:1628997_at:34:273; Interrogation_Position=191; Antisense; CATATGGGCGTTTCCTTGCCGATGG
>probe:Drosophila_2:1628997_at:239:317; Interrogation_Position=261; Antisense; GCCTGGAGTCCAAGAATCCGCTCAA
>probe:Drosophila_2:1628997_at:415:445; Interrogation_Position=319; Antisense; GATGAACCGACACTACAACGATGAG
>probe:Drosophila_2:1628997_at:82:381; Interrogation_Position=403; Antisense; GAACCGCATCAAACTCGACAACTAC
>probe:Drosophila_2:1628997_at:286:459; Interrogation_Position=432; Antisense; GATATCGCTACATAGTGCTGGTCAC
>probe:Drosophila_2:1628997_at:297:651; Interrogation_Position=453; Antisense; TCACTGTGGGCGAGTTCCTGATGCA
>probe:Drosophila_2:1628997_at:230:607; Interrogation_Position=471; Antisense; TGATGCAGGGCCTCTACTCCATGGT
>probe:Drosophila_2:1628997_at:550:269; Interrogation_Position=490; Antisense; CATGGTCAACTTCCTGTGGGATGCT
>probe:Drosophila_2:1628997_at:511:511; Interrogation_Position=530; Antisense; GTGACCTACAGCGTGGAGAGACCCT
>probe:Drosophila_2:1628997_at:428:425; Interrogation_Position=545; Antisense; GAGAGACCCTCGTACTTTGCAGTCT
>probe:Drosophila_2:1628997_at:503:261; Interrogation_Position=571; Antisense; CACCACCTTTTACCTGTACTACGAT
>probe:Drosophila_2:1628997_at:65:13; Interrogation_Position=594; Antisense; ATTAAGAACGCGATTCCAGGGCCCT
>probe:Drosophila_2:1628997_at:220:581; Interrogation_Position=618; Antisense; TGGCGCGTTCCACTTGGTAATAAAA

Paste this into a BLAST search page for me
GGATCGCTGACCAAGTCCCATATGGCATATGGGCGTTTCCTTGCCGATGGGCCTGGAGTCCAAGAATCCGCTCAAGATGAACCGACACTACAACGATGAGGAACCGCATCAAACTCGACAACTACGATATCGCTACATAGTGCTGGTCACTCACTGTGGGCGAGTTCCTGATGCATGATGCAGGGCCTCTACTCCATGGTCATGGTCAACTTCCTGTGGGATGCTGTGACCTACAGCGTGGAGAGACCCTGAGAGACCCTCGTACTTTGCAGTCTCACCACCTTTTACCTGTACTACGATATTAAGAACGCGATTCCAGGGCCCTTGGCGCGTTCCACTTGGTAATAAAA

Full Affymetrix probeset data:

Annotations for 1628997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720