FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628998_at:

>probe:Drosophila_2:1628998_at:286:413; Interrogation_Position=1054; Antisense; GACCAACAAGTTGTCACGCGTGGAG
>probe:Drosophila_2:1628998_at:227:495; Interrogation_Position=1066; Antisense; GTCACGCGTGGAGTCAATATTAAAC
>probe:Drosophila_2:1628998_at:646:689; Interrogation_Position=1140; Antisense; TATTGAACCAAGCACAAACGGCAAG
>probe:Drosophila_2:1628998_at:26:197; Interrogation_Position=1156; Antisense; AACGGCAAGAGTGCATCCGCGTAAA
>probe:Drosophila_2:1628998_at:89:303; Interrogation_Position=1172; Antisense; CCGCGTAAAGCGGATACACTTATTG
>probe:Drosophila_2:1628998_at:628:87; Interrogation_Position=1230; Antisense; AGTCTTGCACGGAATTTTCTCGTCA
>probe:Drosophila_2:1628998_at:166:563; Interrogation_Position=1255; Antisense; GGAAGACGTTAAGTTGACGCCAACT
>probe:Drosophila_2:1628998_at:705:673; Interrogation_Position=1306; Antisense; TAGGTGTTCGCAAACTAAGGTCAGA
>probe:Drosophila_2:1628998_at:526:441; Interrogation_Position=1347; Antisense; GATGCAAATGTTGCGTCCAATTTAG
>probe:Drosophila_2:1628998_at:531:505; Interrogation_Position=1361; Antisense; GTCCAATTTAGAATCCACGGAATAT
>probe:Drosophila_2:1628998_at:245:377; Interrogation_Position=1414; Antisense; GAAGAATTACTCCATCGGATACGAT
>probe:Drosophila_2:1628998_at:72:231; Interrogation_Position=1473; Antisense; AATGTCTGCAAAATTTCGTTCCAAA
>probe:Drosophila_2:1628998_at:334:21; Interrogation_Position=1515; Antisense; ATATTTTCTATTTTCAACTGGACTG
>probe:Drosophila_2:1628998_at:499:513; Interrogation_Position=975; Antisense; GTGATCTGCGATCCAATCTTAATTT

Paste this into a BLAST search page for me
GACCAACAAGTTGTCACGCGTGGAGGTCACGCGTGGAGTCAATATTAAACTATTGAACCAAGCACAAACGGCAAGAACGGCAAGAGTGCATCCGCGTAAACCGCGTAAAGCGGATACACTTATTGAGTCTTGCACGGAATTTTCTCGTCAGGAAGACGTTAAGTTGACGCCAACTTAGGTGTTCGCAAACTAAGGTCAGAGATGCAAATGTTGCGTCCAATTTAGGTCCAATTTAGAATCCACGGAATATGAAGAATTACTCCATCGGATACGATAATGTCTGCAAAATTTCGTTCCAAAATATTTTCTATTTTCAACTGGACTGGTGATCTGCGATCCAATCTTAATTT

Full Affymetrix probeset data:

Annotations for 1628998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720